During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
It can't be released by photosynthesis
Answer:
a. food pellet
Explanation:
In classical conditioning, an unconditioned stimulus is the stimulus that naturally elicits an unconditioned response. The unconditioned stimulus is usually paired with a neutral stimulus, and after pairing with a neutral stimulus, the neutral stimulus becomes a conditioned stimulus that elicits a conditioned response alone.
In the experiment described above in the question, <em>the unconditioned stimulus is the food pellet,</em> which naturally elicits the response of the rat to wait at the far left corner of the cage. The neutral stimulus which is paired with the food pellet is the vanilla scent, which now becomes the conditioned response, when paired alone.
Answer:
By allowing the establishment of geological timescales, it provides a significant source of information about the ages of fossils and the deduced rates of evolutionary change. Radiometric dating is also used to date archaeological materials, including ancient artifacts.
Explanation:
hope it helps
