1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Misha Larkins [42]
3 years ago
9

List and describe two characteristics of all living things

Biology
1 answer:
Mice21 [21]3 years ago
7 0

Hello User,

All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing. When viewed together, these characteristics serve to define life.

  • Living things are made of cells. Cells are the basic building blocks of living things
  • Living things have movement. This movement can be quick or very slow.
  • All living things have a metabolism
  • Living things grow
  • Response to environment.
  • Reproduction.

You might be interested in
What type of microscope gives the highest amount of magnification?
umka2103 [35]
Optical microscope.
Hope this helps.
4 0
3 years ago
Read 2 more answers
A nurse is caring for a client with the diagnosis of schizophrenia. during assessment the nurse identifies both positive (type i
aleksandr82 [10.1K]
There is no options to select
3 0
3 years ago
Name three cell appendages
mel-nik [20]
The answer is a slim layer, Flagella, and a Fimbriae

Hope this helps!!
5 0
3 years ago
Which two elementsare primary components of an MMP molecule
katrin2010 [14]
Matrix Metalloproteases (MMPs) are a part of metalloproteinase enzymes family playing an vital part in healing wounds such as physiological or pathological processes and even in morphogenesis, reproduction, embryonic development, tissue remodeling, arthritis, cancer and cardiovascular disease. MMPs are a product by activated inflammatory cells (neutrophils and macrophages) and wound cells (epithelial cells, fibroblasts and vascular endothelial cells). <span>Membrane-Type MMPs (MT-MMPs) is a subgroup of MMPs which is helpful in breaking down of extracellular material as well as in handling of biological molecules varieties. </span>
7 0
3 years ago
Is there any one who knows how to answer the biology question above
Aliun [14]

Answer:

1.. 10,000 joules

2. 1,000 joules

3. 100 joules

Explanation:

This is due to the 10% Rule. The 10% Rule states that on average 90% of energy stays at its current level while 10% is passed down when the holder of the energy is consumed.

7 0
3 years ago
Other questions:
  • There are two types of cell division the first produces cells that are identical to the original cell the second produces cells
    5·1 answer
  • How are excited electrons from stage 1 used in stage 2 of photosynthesis. A. carbon fixation B. splitting by water C. formation
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the cell membrane is made of
    7·2 answers
  • Each side of a block measures 5 cm. What is the volume of the block??
    14·2 answers
  • Explain how dysfunction at one level of organization impacts other levels and provide an example.
    11·1 answer
  • What are the advantages and the disadvantages of using a resource person in teaching a first aid lesson
    7·1 answer
  • Why would an ecosystem With only a few different types of organizations to be more susceptible to disruption in an ecosystem wit
    13·1 answer
  • PLEASE HELP, i’ll give you brainliest if it’s right please
    11·1 answer
  • PLEASE ANSWER ASAP
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!