1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivenika [448]
3 years ago
7

tar Size: Match the star size with its description. Match Term Definition Medium-sized A) Most of the stars in the universe are

this type of star Dwarf B) The largest stars Neutron star C) Stars that are up to 1,000 times bigger than the sun Supergiant D) Stars that are about the same size as the Earth Giant E) The smallest type of star
Biology
1 answer:
Alina [70]3 years ago
7 0
 Medium sized: DDwarf: A Neutron star: ESupergiant: B
Giant: C 

Hope this helps [:
You might be interested in
The original habitat of the North American maggot fly, Rhagoletis pomonella, was native hawthorn trees. About 200 years ago, som
Readme [11.4K]

Answer:

From the Question A is the ANSWER

A. Because apples mature more quickly than hawthorn fruit, the apple-feeding flies have been selected for more rapid development

This Will result to temporary isolation between the hawthorn and Apple maggot flies

4 0
3 years ago
HOTs: A type of mouse that lives in the desert has light brown fur. The color of the sand in the desert is also light brown. Whe
netineya [11]

Answer:

the light brown mouse

Explanation:

because then they would be able to blend in with the sand

7 0
2 years ago
Unlike a eukaryotic cell, a prokaryotic cell does not have
allsm [11]
C. The nucleus does not exit within a prokaryotic cell
5 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which cellular structure makes it possible for a cell to differ structurally and biochemically from its surroundings?
11111nata11111 [884]

<u>Answer:</u>

<em>A plasma membrane is the cellular structure that makes it possible for a cell to differ structurally and biochemically from its surroundings. </em>

<u>Explanation:</u>

<em>Plasma membrane</em> is the surrounding of all the cells. The function of plasma membrane in a cell is to regulate the incoming and outgoing elements from the cell.

<em>Phospholipid bilayer</em> is the main composition of plasma membrane. It makes the cell different from each other structurally as well as makes the cell different in <em>chemical composition </em>too.

5 0
3 years ago
Other questions:
  • How do the number of chromosomes in a female scorpion's egg cells (gametes) compare with the number in her body (somatic) cells?
    11·2 answers
  • Whats the shortest day of the year in the northern hemishere?
    9·1 answer
  • Some reptiles, like snakes, have olfactory receptors (smell) _____.
    5·1 answer
  • Define immigration and emigration
    15·2 answers
  • Can someone help me
    6·1 answer
  • What is the result of slow movments of tectonic plates
    13·1 answer
  • Measuring Populations (brainliest)
    12·2 answers
  • Help plz for the 3 of emmm!<br> Plzzzz and thank you!
    8·1 answer
  • ANSWER IS IN PHOTO!!!!!!!!!
    12·2 answers
  • C cells of the thyroid gland secrete __________. C cells of the thyroid gland secrete __________. tetraiodothyronine cortisol ca
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!