Answer:
From the Question A is the ANSWER
A. Because apples mature more quickly than hawthorn fruit, the apple-feeding flies have been selected for more rapid development
This Will result to temporary isolation between the hawthorn and Apple maggot flies
Answer:
the light brown mouse
Explanation:
because then they would be able to blend in with the sand
C. The nucleus does not exit within a prokaryotic cell
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
<u>Answer:</u>
<em>A plasma membrane is the cellular structure that makes it possible for a cell to differ structurally and biochemically from its surroundings. </em>
<u>Explanation:</u>
<em>Plasma membrane</em> is the surrounding of all the cells. The function of plasma membrane in a cell is to regulate the incoming and outgoing elements from the cell.
<em>Phospholipid bilayer</em> is the main composition of plasma membrane. It makes the cell different from each other structurally as well as makes the cell different in <em>chemical composition </em>too.