First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
The answer is ring-like.
Clams have ganglia that form a ring around esophagus and that is why this network is called ring-like.
I think the first one is b
Answer:
It look good to me but I dont know for sure so we will see
Answer:
Option (d).
Explanation:
Telomere may be defined as the repetitive DNA sequence present at the ends of the chromosomes. Telomeres consists of the nucleotide sequence rich in G and consists of vertebrate sequence AGGGTT.
The mutation in telomerase enzyme can cause the excessive replication of the telomeres. These leads to the excessive cellular proliferation and makes the cell immortal. This extensive growth of telomere is one of the maine reason of the cancer development.
Thus, the correct answer is option (d).