The correct answer that would best complete the given statement above would be the first option. Coral reefs are built by a small organism called a polyp. The polyp creates the structure of the coral reef by building a CUP out of a calcium carbonate. The skeletons of these tiny corals s<span>ecreted by the lower portion of the polyp. Hope this answer helps.</span>
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG
The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
Umm the answer is In the picture hope this helps my guy
Answer:
Surface area increase more absorption of light and also is related to water loss
For example the leaves of tress in dry areas are reduced to pines and thorns to prevent water loss this is seen in tress like Cactus in the deserts
Explanation:
