1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
2 years ago
5

Need help

Biology
1 answer:
tia_tia [17]2 years ago
3 0

Answer:

Polarity causes water molecules that become attracted to each other. Cohesion is known for the attachment of two of the same substance.

Explanation:

You might be interested in
The genetic make-up of the offspring is the<br> A.phenotype<br> B.genotype
viktelen [127]

Answer:

Genotype

Explanation:

Phenotype refers to traits that physically appear, genotype refers to genetic traits

5 0
3 years ago
What do the two arrows in the diagram most likely represent?
Schach [20]

Answer:

d

Explanation:

i took the test

4 0
3 years ago
Read 2 more answers
The smallest muscle of the sural region is the ________ muscle.
algol13
The smallest muscle of the sural region is the <span>plantaris</span> muscle.
5 0
3 years ago
In fish or flaxseed the best source of omega3 fatty acids? Why?
Katena32 [7]
Fish because it is full of healthy oils. But depends on the kind of fish. I know salmon is rich in omega 3 fa
3 0
3 years ago
The process of determining the preferred number and spacing of children in one's family and choosing the appropriate means to ac
kozerog [31]
The answer for the question is Family planning.
Family planning allows people to attain their desired number of children and determine the spacing of pregnancies. It is achieve through use of contraceptives methods and the treatment infertility. They are different methods of contraception, including long-acting reversible contraception such as IUD, hormonal contraception such as pill among others. 

7 0
3 years ago
Other questions:
  • The nutrient found most abundantly in both the human body and in foods is what
    13·1 answer
  • What happens to the quantity of clean water as water pollution increases
    10·1 answer
  • Australopithecines have been found mainly in two african regions. these areas exhibit unique geological conditions that have all
    8·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is the term for a condition whereby small amounts of urine leak from a bladder that is always full as a result of a spinal
    15·1 answer
  • Classify the sets of bones below as being part of the axial skeleton or the appendicular skeleton.
    9·2 answers
  • Someone please help me ! what is a monomer?
    11·2 answers
  • What can the result be if DNA replication does not occur without errors?
    12·1 answer
  • Just Please someone help me :(
    8·1 answer
  • List one factor that you imagine would limit settlement on top of living organisms. The panels hang vertically from the side of
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!