1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
damaskus [11]
2 years ago
12

The blank are part of the circulatory system that transport blood throughout the body​

Biology
1 answer:
Nataliya [291]2 years ago
8 0

Explanation:

The arteries (red) carry oxygen and nutrients away from your heart, to your body's tissues. The veins (blue) take oxygen-poor blood back to the heart. Arteries begin with the aorta, the large artery leaving the heart. They carry oxygen-rich blood away from the heart to all of the body's tissues.

You might be interested in
15. What is the product of meiosis?
Zielflug [23.3K]

Answer:

4 haploid daughter cells

7 0
4 years ago
Read 2 more answers
Will Give brainlyst
Finger [1]
B A D C (I think not 100% on this one)
4 0
3 years ago
Which organism is a fungus-like protist?
Sloan [31]
Slime molds would be a fungus-like protist. They usually use psuedopods to move around. 
7 0
3 years ago
Read 2 more answers
DNA contains instructions for making the different molecules, such as proteins, that a cell needs to grow and function. To use t
ohaa [14]

Answer:

C. transcribed, mRNA

Explanation:

DNA, also known as deoxyribonucleic acid, is a molecule that holds genetic information needed to make other molecules in living organisms. However, before this genetic information can be harnessed, it needs to be expressed via two processes called transcription and translation.

Transcription is the first of the two processes that take place during genetic expression. It involves the synthesis of mRNA molecule from a DNA template. In other words, the DNA must first be TRANSCRIBED into mRNA.

3 0
3 years ago
What was their motivation for exploration?
Pie

Answer:

There are three main reasons for European Exploration. Them being for the sake of their economy, religion and glory. They wanted to improve their economy for instance by acquiring more spices, gold, and better and faster trading routes. Also, they really believed in the need to spread their religion, Christianity.

Explanation:

3 0
3 years ago
Other questions:
  • Why is solar energy important
    13·1 answer
  • How do decaying leaves affect rocks
    7·1 answer
  • What is one reason why many geologists did not at first accept the theory of continenal drift ?
    8·1 answer
  • Deer are mammals, and therefore have systems that are basically the same as other mammals.
    14·2 answers
  • Which of the following forest management practices is the most harmful to forest ecosystems?
    7·2 answers
  • Spores:
    9·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • what process allows plants to convert sunlight energy into chemical energy
    5·1 answer
  • 1.How Can You Classify Single-Celled Organisms?
    11·1 answer
  • Why are the fossils of the mesosaurus species,that once lived together, found in different locations on earth now?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!