1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adelina 88 [10]
3 years ago
14

Your cardiovascular system is made up of what three body parts?

Health
2 answers:
yan [13]3 years ago
7 0

Answer:

It consists of the heart, and a closed system of vessels called arteries, veins, and capillaries.

sukhopar [10]3 years ago
3 0

Answer:

The Heart, Lungs, and arteries

Explanation:

You might be interested in
How hypokinetic diseases and hyperkinetic conditions affect personal lives​
drek231 [11]
In contrast to hypokinetic diseases, hyperkinetic disorders appear to be associated with abnormally low basal ganglia output from GPi and SNr. Reduced basal ganglia output may arise from a shift of the balance of activity between direct and indirect pathway activity toward the direct pathway.so sedentary living cost our 150 billion ever year , kinetic health problems caused by to much (physical activity)
7 0
3 years ago
Advice for patient undergoing hemodialysis
wariber [46]
Have the patient stay calm. Ten check their kidneys
8 0
3 years ago
Which of the following are functions of the skeletal system?
Leona [35]
To provide the body with a strong and mobile framework and to allow the body to move. I also I believe the skeletal system Provides the body with a strong mobile....and to supply the body with minerals

The immune system usually protects from bacteria, injury and diseases. 
3 0
3 years ago
True or false Rice is a staple food in the Asian diet.
scoundrel [369]

Answer:

Yes, but rice is  not that healthy it has a lot of carbs

5 0
3 years ago
Read 2 more answers
Idenify health risks associated with anorexia
irina1246 [14]
<span>Idenify health risks associated with anorexia

</span><span>-cessation of menstruation (amenorrhea), infertility,
-dry skin
-hair loss,
-dental problem
-abdominal pain,
-headache,
-dizziness (hypotension),
-vision problems
-cold feet and hands,
-cramps,
-insomnia,
-muscular weakness,
-abnormal heart rhythm.
-osteoporosis
-vitamin deficiency, mineral(anémia)
-</span><span>excessive tiredness</span>


6 0
4 years ago
Other questions:
  • Which information should be verified to ensure that a source of information about healthcare products and services is authentic
    10·2 answers
  • Name one Disadvantage that a left-handed softball player might have over a right-handed softball player.
    15·1 answer
  • which system is affected when tobacco reduces the flow of oxygen to the brain potentially leading to a stroke? a.circulatory sty
    5·2 answers
  • What does the body use calories for?
    6·2 answers
  • Some __________ are used for physician-assisted suicide and for execution by lethal injection. A. dissociatives B. antihistamine
    11·2 answers
  • How old do you have to be to do a breast reduction?
    8·2 answers
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • What are the stages of childbirth
    11·1 answer
  • Which of the following has amino acids that are essential for certain metabolic functions.
    15·2 answers
  • How to deal with depression and a mentally abusive house please help it’s a actual issue and I can’t get away from it
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!