1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galina1969 [7]
2 years ago
10

Show working out ignore the first

Biology
1 answer:
Ainat [17]2 years ago
4 0

1. = <u>Surface</u><u> </u><u>area</u>

Volume

= <u>(</u><u>2</u><u> </u><u>*</u><u> </u><u>1</u><u>)</u><u> </u><u>m</u><u>²</u>

(1*2*0.5) m³

= 2 m-1 (the negative 1 is an exponent).

2. for elephant,

= S/V

= 25/10

= 2.5 m-1

for pigeon,

= S/V

= 0.5/0.05

= 10 m-1

Pigeon has the larger surface area to volume ratio.

3.

= S/V

= <u>(</u><u>4</u><u>0</u><u> </u><u>*</u><u> </u><u>3</u><u>0</u><u>)</u><u>m</u><u>²</u><u> </u><u> </u><u> </u><u> </u>

(40*30*40) m³

= 0.025 m-1

4.

= S/V

= <u>(</u><u>4</u><u> </u><u>*</u><u> </u><u>6</u><u>)</u><u> </u><u>c</u><u>m</u><u>²</u>

(4*6*5) cm³

= 0.2 m-1

hope you understand. All the best!

You might be interested in
Explain in your own words, why an avocado fruit has a higher biotic potential than a tangerine fruit.
ale4655 [162]

Explanation:

Each avocado fruit contains one large seed. Each tangerine fruit contains a dozen seeds or more. Because the tan- gerine tree produces more seeds per fruit, it has a higher biotic potential than the avocado tree.

7 0
2 years ago
Plz help I will mark you brainlist plz help ​
mina [271]

Answer:

By running them under water. The water will separate the rocks from the dirt.

8 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
If the Earth were closer to the Sun, the intense heat might evaporate the oceans and create an atmosphere similar to the atmosph
Anastaziya [24]
Venus is the answer. That planet has a dense atmosphere of CO2, which has produced a runaway greenhouse effect. 
8 0
3 years ago
Read 2 more answers
Mention the type of census operation​
Oxana [17]

Answer: enumeration area

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following happens at mid-ocean ridges and is essential for the process of plate tectonics being able to continue?
    7·2 answers
  • What is lactic acid?
    14·2 answers
  • What are 3 types of stress
    15·2 answers
  • Why doesn't the moon move away from earth
    12·2 answers
  • 1. a. Environmental science is compsed of several different fields of science, including life science, which is the study of liv
    8·1 answer
  • Which statement describes the change that has occurred over time in Graph A?
    7·1 answer
  • The Law of Independent Assortment describes why there is so much
    5·1 answer
  • You work for a company that manufactures food products. a new "wonder food" contains only carbon, oxygen, and hydrogen. at this
    6·1 answer
  • Phương pháp cố định mẫu
    5·1 answer
  • Doubtnut User Invited you to their study group Doubtnut buddy group. Accept the invite to study together. https://doubtnut.app.l
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!