1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
2 years ago
8

True or False: The pulmonary circuit allows deoxygenated blood to become oxygenated.

Biology
1 answer:
amid [387]2 years ago
4 0

Answer:

true

Explanation:

trust me bro ya know whole lotta quick mafs

You might be interested in
PLEASE HELP!!Why might humans not have widespread regeneration abilities?
aev [14]

Answer:

Humans have some stem cells, but those cells are not easily available to help with healing. Most other mammals are the same, so they aren't good at regeneration either. Amphibians and some fish have stem cells that are more easily available, and are usually pretty good at regeneration.

7 0
2 years ago
When a virus invades a host the most common threat is
mylen [45]
The answer is c because we just learned about it today. Viruses destroy cells
6 0
3 years ago
Can molecules be made of one or more particles?
Tasya [4]

A molecule is the smallest particle of a substance that exists independently. Molecules of most elements are made up of only one of atom of that element. Oxygen, along with nitrogen, hydrogen, and chlorine are made up of two atoms. ... The oxygen molecules are bonded or stuck together.

4 0
3 years ago
Brandon works on a livestock farm each day he takes his sheep grazing in the mountains he feels the air getting cooler as he cli
Naya [18.7K]
As Brandon climbs the mountain, he is getting into thinner and thinner air (air pressure is decreasing). All other things held constant, decreasing air pressure means decreasing temperature. As the air pressure decreases, particles get further apart and lose energy as they move about and collide into one another less and less frequently.
5 0
3 years ago
Read 2 more answers
Some proteins owe their functions to the three dimensional shape they have; what is responsible for holding the shape of a prote
irga5000 [103]

Protein denaturation results in a disruption of the secondary and tertiary structure.  A denatured protein does not have the function it previously had. Some proteins owe their functions to the three dimensional shape they have; what is responsible for holding the shape of a protein is the R-group interactions. 

5 0
3 years ago
Other questions:
  • Will be given brainliest!!!
    11·1 answer
  • What do you think would happen to earths tides if the moon was not there
    13·1 answer
  • Food provides the human body with all of the following but . .
    6·1 answer
  • ​ Tao wakes up his roommate Don so that he doesn’t miss his morning classes again. Don tells Tao, "I wish you hadn’t woken me up
    7·2 answers
  • Which species is one of more than 800 protected by the Convention on International Trade in Endangered Species?
    9·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The downfall of a tragic character is the result of __________.
    12·2 answers
  • 1. Key Concept What are<br> dominant and recessive alleles?
    10·1 answer
  • Which of the following phrases best describes the function of meiosis
    10·1 answer
  • What happens to mRNA after transcription ?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!