Please help dont put down some answer please i will give you good review and lots of points.

Which of the following explains why mitochondria appear much less elongated in electron micrographs than they do in images produ

LenaWriter [7]

Hello there.

Which of the following explains why mitochondria appear much less elongated in electron micrographs than they do in images produced by fluorescence microscopy?

C. cross-sectioning of mitochondria gives misleading

3 0

4 years ago

The bones of the arms, legs, pelvis, and shoulder area

crimeas [40]

The bones of your arms are called humerus, while your forearms are composed of two bones, the radius and ulna. The bones of your fingers are called metacarpals and each one of those small bones are called phalanges.

The bones of your shoulders are composed of the clavicle, the bony part seen just right under the neck. Part of the shoulder area is the scapula, which is located at the back part of the body attached to the upper part of the ribs. They are the triangle-shaped bones you feel when you cross your arms at the back.

The bones of your thighs are called femur, they are the largest bones in your body. While the bones of your legs are called tibia and fibula. The bones of your toes are called tarsals and each are composed of smaller bones called metatarsals. Your heels also have bones and they are called calcaneus.

The bones of your pelvis are called Coxal bones as a whole but they are composed of the illium (biggest part of your hips); the pubic bone, located along the reproductive organ; the sacrum and coccyx all located at the base of the spine.

8 0

3 years ago

The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

liubo4ka [24]

The mRNA generated below was produced in the <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

The synthesis of the mRNA s called transcription

The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.

It requires nucleotide triphosphates as substrates
catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0

3 years ago

Drag each Moon phase to the correct location on the image.

ruslelena [56]

The correct order of the given moon phases starting with new moon is new Moon, waxing crescent Moon, first quarter Moon, waxing gibbous Moon, full Moon, waning gibbous Moon, last quarter Moon.

<h3>What are Moon phases?</h3>

This cycle has been divided into four primary Moon phases: New Moon, First Quarter, Full Moon, and Last Quarter. Waxing Crescent, Waxing Gibbous, Waning Gibbous, and Waning Crescent are the four secondary phases.

The missing image of the question is attached at the last.

The correct order of the given moon phases starting with new moon is new Moon, waxing crescent Moon, first quarter Moon, waxing gibbous Moon, full Moon, waning gibbous Moon, last quarter Moon.

Thus, this way the lunar phases can be placed in the correct order.

For more details regarding moon phases, visit:

brainly.com/question/2285324

#SPJ1

3 0

2 years ago

Which of the following best explains why enzymes are necessary for many cellular reactions?

kow [346]

Answer:

C. The reactions take up too much space in the cell if the enzymes are missing.

Explanation:

6 0

3 years ago