1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-Dominant- [34]
3 years ago
14

An organism’s scientific name consists of which TWO taxonomic groups? (Select the TWO correct answers).

Biology
1 answer:
Paha777 [63]3 years ago
5 0

Answer:

Scientists use a two-name system called a Binomial Naming System. Scientists name animals and plants using the system that describes the genus and species of the organism. The first word is the genus and the second is the species

You might be interested in
How do the abiotic factors of the ocean affect the organisms that live there
Mariana [72]
So to answer this question you need to know what abiotic factors are. Abiotic factors are non-living chemical and physical parts of an environment. To answer your question the abiotic factors of the ocean affect the organisms that live there since without parts of an environment, organisms wouldn't have any place to live.
8 0
2 years ago
How does overtillage harm soil? a. Overtillage can increase the rate of humus decomposition. b. Overtillage can increase the wat
MrRa [10]
<span><span>This is your answerOvertillage can increase the rate of humus decomposition.</span></span>
5 0
2 years ago
Read 2 more answers
Why do you think a growing human population means a mass extinction event for Earth’s animals? Cite your evidence.
Lunna [17]

Hello,

A “biological annihilation” of wildlife in recent decades means a sixth mass extinction in Earth’s history is under way and is more severe than previously feared, according to research. Scientists analysed both common and rare species and found billions of regional or local populations have been lost. They blame human overpopulation and over consumption for the crisis and warn that it threatens the survival of human civilization, with just a short window of time in which to act.

Hope this helps!!!! Happy Holidays!!!! (:

4 0
2 years ago
Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle.
lana [24]
The correct answer for the question that is being presented above is this one: "B. Aldosterone-regulated Na+ pump activity would increase dramatically to stabilize the osmotic concentration gradient."

Here are the following choices:
<span>A. The final urine output would increase greatly because of the increase in ADH-regulated water reabsorption.
<span>B. Aldosterone-regulated Na+ pump activity would increase dramatically to stabilize the osmotic concentration gradient.
</span>C. The increased solute concentration in the vasa recta would stimulate additional water reabsorption.
</span><span>D. The concentration gradient of the renal medulla would remain unaffected.</span>
4 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Other questions:
  • Which kind of molecules can pass unaided through the cell membrane?
    11·1 answer
  • What symbiotic relationship is leech and alligator?
    8·1 answer
  • Which organism contributes to soil formation in primary succession? A) lichens B) grass C) small plants D) trees
    12·2 answers
  • Where is the cardiovascular control center in the brain?
    15·1 answer
  • In some chordates, pharyngeal slits develop into _____. choose one answer.
    15·1 answer
  • An increase in the volume of the alveoli would directly result in
    13·1 answer
  • This space station has plants growing inside it, and astronauts who eat the fruits and vegetables from those plants. Because it
    5·1 answer
  • Which has more momentum: a bowling ball with a velocity of 7.0 m/s or a basketball with a velocity of 9.0 m/s? The bowling ball
    14·1 answer
  • Why do I not get sick when I eat cheese with holes in it, but I do get sick when I eat chicken that has gone bad?
    10·1 answer
  • What does it mean when your immature granulocytes are high?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!