1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pickupchik [31]
3 years ago
12

Please Answer FAST ASAP

Biology
2 answers:
Anika [276]3 years ago
4 0
No because we are changing and we are much different then other animals
Lubov Fominskaja [6]3 years ago
3 0

Answer:

No

Explanation:

The human body constantly develops and changes throughout the human life cycle, and food provides the fuel for those changes. The major stages of the human lifecycle include pregnancy, infancy, the toddler years, childhood, puberty, older adolescence, adulthood, middle age, and the senior years. Hope this helps you! Have a great day to whoever reads this!

You might be interested in
What is the mRNA made during transcription of the following DNA template?
CaHeK987 [17]
The correct answer is A because G and C work together, and T and A work together, except A turns into U when transferring to mRNA.
5 0
3 years ago
WILL GIVE BRAINLIEST!!!
max2010maxim [7]

The shown lipid is a saturated triglyceride.

A type of lipid is known as a triglyceride which is an ester derived from glycerol combined with three fatty acid molecules.

8 0
3 years ago
Read 2 more answers
Imagine you are a science teacher, and your students are performing a flame test. this experiment involves the use of a bunsen b
choli [55]

The teacher should discuss safety procedure with students at the beginning of the experiment or laboratory assignment.  The teacher should give list of rules for students.

1.       Always wear safety goggles.

2.        Never touch or rub eyes of face during science investigation.

3.       Keep lids on when not in use.

4.       Never use broken/chipped glassware. 

4 0
3 years ago
Read 2 more answers
Researchers have discovered that children diagnosed with adhd have a decrease in size of the left prefrontal cortex of the brain
Evgesh-ka [11]
Left prefrontal cortex
7 0
3 years ago
Models help people study things that _____. ( science )
nikitadnepr [17]

Answer:

C. Can't be observed directly

5 0
3 years ago
Other questions:
  • Which question can be answered using the scientific process?a. how long does it take a paper bag to break down?b. should people
    14·2 answers
  • Which organelle is paired properly with its function?
    12·1 answer
  • Why does regular exercise prevent flexibility issues
    9·2 answers
  • What would become fossils first a fish who died on the ocean floor or a mouse who died on the forest floor
    15·1 answer
  • What was the first vitamin to be discovered scientifically
    12·1 answer
  • What best explains the relationship between structure and function of the cell membrane?
    10·1 answer
  • Why are chromosomes visible under a microscope during cell division
    13·1 answer
  • A peptide bond is always between the elements:
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Would extrusive or intrusive igneous rocks have the largest crystals? Why
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!