1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivenika [448]
3 years ago
12

Ribosomes are the most

Biology
1 answer:
sdas [7]3 years ago
7 0

Answer:

Explanation:  

The nucleolus makes rRNA, which makes up ribosomes. The Golgi apparatus gets vesicles of proteins from the ER (which contains ribosomes) to process, sort, and ship the proteins to where they are needed. The rough endoplasmic reticulum and the cytoplasm houses the ribosomes.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
What large peninsula is linked to the mainland of greece by the isthmus of corinth?
cluponka [151]
<span>Peloponnesus is the answer to the question</span>
3 0
3 years ago
A student placed a disk of filter paper in each of the following solutions: disinfectant 1, disinfectant 2, disinfectant 3, and
beks73 [17]
<span>d. Disk soaked in distilled water

Experimentation is a scientific process wherein you test and verify a hypothesis based on its assumption is going to be supported or negated (null hypothesis). Hence experimentation involves the independent and dependent variable, also control variable as a level in the IV. </span>
8 0
3 years ago
Which type of muscle tissue is pictured?
malfutka [58]

Answer:

Smooth

Explanation:

The muscle tissue from the smooth muscles looks layered and connected. Also, I found the diagram online.

4 0
3 years ago
Prokaroytic and eukarayotic cells
asambeis [7]

Answer:

A prokaryote is a cellular organism that lacks an envelope-enclosed nucleus. The word prokaryote comes from the Greek πρό and κάρυον. In the two-empire system arising from the work of Édouard Chatton, prokaryotes were classified within the empire Prokaryota.Eukaryotic cells are cells that contain a nucleus and organelles, and are enclosed by a plasma membrane. Organisms that have eukaryotic cells include protozoa, fungi, plants and animals. These organisms are grouped into the biological domain Eukaryota.

Explanation:

8 0
3 years ago
Other questions:
  • A physical property that does not depend on the amount of matter in the substance is A) extensive. B) measurable. C) intensive.
    13·1 answer
  • Question 9(Multiple Choice Worth 4 points)
    15·2 answers
  • According to the nebular hypothesis, when did nuclear fusion begin?
    13·1 answer
  • Geographic isolation may result in<br> A. extinction<br> B. speciation
    10·2 answers
  • Which process must occur to change lipids into glycerol and three fatty acids?
    10·1 answer
  • Which one of the following items would be best measured using meters?
    11·1 answer
  • Hey guys i need some good facts about mars and pluto and fast will give brailiest and five stars
    11·1 answer
  • There are 12 pairs of curved bones called X in
    9·1 answer
  • Please help help <br> its science
    6·1 answer
  • Brendan made a chart to categorize the characteristics of animals.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!