1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masya89 [10]
2 years ago
8

In guinea pigs, smooth coat (S) is dominant over rough coat (s). If an SS guinea pig is crossed with an ss guinea pig, what poss

ible outcome of guinea pigs in the offspring would you predict?
Biology
2 answers:
jeka57 [31]2 years ago
6 0

Answer: All offspring will be Ss and have smooth coats.

Verdich [7]2 years ago
5 0

Answer:

All offspring will be Ss and have smooth coats.

You might be interested in
Which organelle's function is CORRECTLY described?
Romashka [77]
I think the organelle whose function is correctly described is mitochondria.
6 0
3 years ago
Proteins made on ribosomes may be further modified within which organelle?
madreJ [45]
D. golgi complex because it receives proteins and lipids from the ER , and packages and diatribes theses substances throughout the cell.
8 0
3 years ago
The study of the chemical reactions of living things is called _____.​
Ipatiy [6.2K]
The study of chemical reactions of living this is called biochemistry.
4 0
3 years ago
Number 3 PLEASEEEE E HELP!!
inysia [295]
A I think but can you get a better picture of the questions
7 0
3 years ago
Read 2 more answers
According to the dichotomous key, the organism pictured would be a member of the kingdom A) Animalia. B) Fungi. C) Eubacteria. D
MAXImum [283]

Answer:

well we need the photo to see what animal its asking

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • The _____ is critical in the cell cycle because it indicates the cell is ready for division. G0 phase G1 phase G2 phase S phase.
    12·2 answers
  • Discuss two ways that all cells are alike?
    12·1 answer
  • This is found in cell membranes and help protect the cell or organelles by allowing/not allowing molecules to enter. What is it?
    9·2 answers
  • In Mendel's work with peas, an F1 hybrid (smooth yellow) was crossed to the recessive (wrinkled green) parent type. In terms of
    11·1 answer
  • Volcanoes are often formed at plate boundaries. This is a convergent plate boundary. From the choices listed, pick the correct d
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • SOMEONE HELP WILL GIVE 70 POINTS AND BRAINLIEST. ASAP!!!!!!!!
    8·1 answer
  • Plz help me with this.....
    5·1 answer
  • How does the amount of water vapor in a region correlate to the amount of rain
    6·1 answer
  • Meme war eli u will get this
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!