1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
2 years ago
10

Which technology has helped improve scientists’ ability to gather scientific data about the movement of sea turtles?

Biology
2 answers:
mylen [45]2 years ago
7 0
Satellite tracking good luck
faltersainse [42]2 years ago
6 0

Answer:

its satellite tracking

Explanation:

i had this question before

You might be interested in
If the dry bulb temperature is 46,and the dew point is 11 degrees celsius,what would be the difference between the wet-bulb and
Andrei [34K]

Answer:

Dew is the condensed water that a person often sees on flowers and grass early in the morning. Dew point varies depending on the amount of water vapor present in the air, with more humid air resulting in a higher dew point than dry air. Furthermore, the higher the relative humidity, the closer the dew point to the current air temperature.

Explanation:

7 0
3 years ago
A client who has been treated for chronic open-angle glaucoma (coag) for 5 years asks the nurse, "how does glaucoma damage my ey
Zigmanuir [339]
<span>causes increased intraocular pressure.</span>
3 0
3 years ago
Which bases are found in a strand of DNA
Evgen [1.6K]
If i remember correctly they should be adenine (A), thymine (T), guanine (G) and cytosine (C). i hope this helps. sorry if they arent all correct.
7 0
3 years ago
Read 2 more answers
Living material that makes up organisms is known as __________.
Andreas93 [3]

Answer:

the answer is B. biomass

7 0
3 years ago
Read 2 more answers
Every part of planet earth is touched by the
ra1l [238]
Soil?
The atmosphere?
Air?

I don't understand how you want this question answered
5 0
3 years ago
Read 2 more answers
Other questions:
  • How does leaf structure facilitate photosynthesis
    15·2 answers
  • A person who is interested in learning more about the "fight or flight" response may pursue a career in
    8·2 answers
  • Darwin noticed that many organisms seemed well suited to
    5·1 answer
  • Unlike mitosis, meiosis usually results in the formation of what?
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Explain how you linked the predator and its prey to a specific environment.
    14·1 answer
  • *50 POINTS* Please write it like "The reaction in this experiment is _______________ (exothermic OR endothermic) because _______
    14·2 answers
  • A fast-growing town requires a new source of power. Because the town is located by a fast-flowing river, the town council votes
    13·1 answer
  • Pointing towards a man, a woman said, his mother is the only daughter of my mother. How is the woman related to the man?.
    6·1 answer
  • How is energy from the sun related to air masses?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!