1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
1 year ago
9

How is energy from the sun related to air masses?

Biology
1 answer:
strojnjashka [21]1 year ago
7 0

Answer:

It is more intense near the equator than it is near the poles due to the Sun's energy. You have warm air over the equatorial regions, and cool air over the polar regions, and these air masses constantly interact with each other, which is crucial to Earth's climate.

Explanation:

You might be interested in
1. Which of the following solid substances could be classified as the most dense?
iragen [17]
D I believe it work hope this work
5 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
How are the ear and the eye alike? How are they different?
Temka [501]

Answer:

SAME They are both senses/ DIFFRENT

and a ear can hear and eyes can see

Explanation:

6 0
3 years ago
Read 2 more answers
6. Calculate the kinetic energy of a baseball thrown by Aroldis Chapman, who holds the world record for fastest pitch. The baseb
GrogVix [38]

Answer:

D

Explanation:

=122

5 0
2 years ago
For natural selection to occur, variation must exist. this is true because without variation
chubhunter [2.5K]
<span>Without variation, there is no difference between members of a population to be "selected for" in the first place. This is a basic tenet of natural selection. A new trait must arise in order to advance or decrease the fitness of the individual, and hence, its ability to pass on its genes.</span>
6 0
3 years ago
Other questions:
  • Which statements describe long-term environmental changes? Check all that apply.
    9·2 answers
  • Baby paolo smiles and coos so often and is so delightful that his parents feel compelled to smile and chatter right back at him.
    12·1 answer
  • The rate at which energy is released by oxidative metabolic processes is known as
    8·1 answer
  • What is instantaneous speciation?
    6·2 answers
  • The shrinking of the Aral Sea has led to altered weather and rainfall patterns over the entire region. This is most likely cause
    7·2 answers
  • Thermal denaturation experiments can be used to follow the transition of double-stranded DNA into single-stranded DNA. Which par
    14·1 answer
  • Those who have positive qualities are often judged more positively on their other qualities.
    7·2 answers
  • The oldest members of the human lineage are the Australopithecines.<br> a. True<br> b. False
    15·1 answer
  • there are five different types of nucleotide bases found in living things. Which is an accurate comparison of the bases found in
    5·1 answer
  • What is the correct order of steps from a DNA code to the formation of a protein?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!