1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
9

***

Biology
2 answers:
kap26 [50]3 years ago
7 0
Biological progression
statuscvo [17]3 years ago
6 0

Biological procession ?

You might be interested in
List 5 ways that pathogens might be spread in a hospital
natta225 [31]
 -sneezing -sexual contact can transfer pathogens from one person to another,-if you have a cut or a break in your skin, microbes can gain direct access to your bloodstream,-by consuming contaminated food and drink.-if the pathogen goes airborne
7 0
3 years ago
True or false: light independent reactions utilize pigments, involve the electron transport system, and are relatively fast reac
VLD [36.1K]

true i think this is right

7 0
3 years ago
Traits are inherited ________ of alleles.
Ira Lisetskai [31]
Through the actions of alleles

7 0
3 years ago
Read 2 more answers
Wich two organ systems work together to inhale oxygen?
Stella [2.4K]
Hey bro is ur lungs. .
3 0
3 years ago
The gravity of the Sun and Moon pulls earth's surface in opposite directions:​
sweet [91]

Answer:

The Moon's gravity pulls more on the planet than the water on the opposite side. These two water bulges on opposite sides of the Earth aligned with the Moon are the high tides. Spring tides occur when the Earth, the Sun, and the Moon are aligned, increasing the gravitational pull on the oceans.

8 0
3 years ago
Other questions:
  • What caused England's Biston betularia moth populations to change over time from light colored to dark colored?
    10·2 answers
  • T or F
    9·1 answer
  • Which part of the nucleotide stores the genetic information?
    15·1 answer
  • Please help with all of these quickly!
    12·1 answer
  • Maria suffers from a bone disease characterized by loss of bone density in which the bones become porous, brittle, and more pron
    15·1 answer
  • Traces of oxygen were probably generated in the early atmosphere through the breakdown of water molecules into oxygen and hydrog
    5·1 answer
  • How much do landscape features on the moon change over
    8·1 answer
  • Which of the following is a major contributor to soil erosion? Agriculture, Urban development, invasive species, deforestation
    15·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • In your own words, describe inertia as if you were trying to teach a sixth grader
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!