1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stealth61 [152]
3 years ago
7

What are three functions that lipids serve in plants and/or animals?

Biology
2 answers:
jok3333 [9.3K]3 years ago
3 0

Answer:

Lipids perform three primary biological functions within the body: they serve as structural components of cell membranes, function as energy storehouses, and function as important signaling molecules.

Sergio [31]3 years ago
3 0
They serve as structural components of cell membranes, function as energy storehouses, and function as important signaling molecules.
You might be interested in
Most reptiles , including lizards and snakes reproduce sexually . Despite this parthenogenesis has been observed to occur natura
Natasha2012 [34]
A is your answer. When only one parent produces the offspring, they are essentially cloning themselves, and it is called asexual reproduction. The offspring only have the genes of the one parent. A lack of genetic diversity is one of the drawbacks to asexual reproduction.
8 0
3 years ago
Mom serves mixed vegetables, including peas, carrots, and corn, with dinner. This side dish is classified as a _________. A) com
34kurt
This side dish is classified as a mixture.
3 0
3 years ago
Read 2 more answers
In three to five sentences, construct an argument for the claim that natural selection leads to evolution. Provide evidence for
AVprozaik [17]

Answer:

Natural selection leads to evolution due to the way reproduction works. In the example of European moths during the industrial revolution, we can see this clearly. When the industrial revolution was going, there was more pollution, hence darkening the skies and leaving ash. Moths, which before were white with occasional black spots dominated the area until pollution effected their environment. Whiter moths were eaten by bird who could easily see them against the black trees and skies. These moths could no longer reproduce, they were dead. Moths with more black could survive longer to reproduce because they were harder to see. As time went along, the moths turned mostly black, showing an example of evolution.

7 0
2 years ago
Compare the composition of pancreatic secretions in the presence of hydrochloric acid and fat
tigry1 [53]
I'm having trouble on this too :(
4 0
3 years ago
This is one explanation of enzyme specificity that states an enzyme and its substrate possess specific complementary geometric s
ArbitrLikvidat [17]

Answer:

here for the points ahah srry

Explanation:

8 0
2 years ago
Other questions:
  • Using at least three sentences, explain the cycling of energy through the processes of photosynthesis and cellular respiration.
    14·1 answer
  • Leaves are important plant structures because they
    9·1 answer
  • 4. How do geologists determine the age of a fault line
    15·2 answers
  • cell membranes · large biomolecule · many high energy bonds · nonpolar covalent bonds · includes waxes and steroids · consists m
    12·2 answers
  • A respiratory therapist is unable to insert a 14 fr suction catheter through the endotracheal tube. the therapist repositions th
    15·1 answer
  • which of the following of mandels conclusions is a necessary foundation for Darwin's theory of natural selection
    7·2 answers
  • List 2 adaptations that helped Darwin's finches survive.?
    8·1 answer
  • Pros and cons for growing and selling GM (Genetically modified) food.
    13·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What types of trees are planted in Ethiopia by professor Legesse Negash?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!