1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
2 years ago
9

Which statement accurately describes the 13 American colonies?

Biology
1 answer:
NARA [144]2 years ago
7 0

Answer: C

Explanation:

You might be interested in
PLEASE HELP!!! <br><br> What is the correct answer for the box?
Charra [1.4K]
The answer to your question is Corruption is exhibited in this scenario.
Have a great day
3 0
2 years ago
Which of the following is a natural cause of acid rain?
arlik [135]
The natural cause of acid rain is the <span>chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air.</span>
8 0
3 years ago
HELP ASAP PLEASE!!!
Leya [2.2K]

3. It produces RNA strands

3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Which of the following sequences is correct for the downhill movement of electrons during cellular respiration? A. glucose – cit
Volgvan

Answer:

B. glucose – NADH – electron transport – O2

Explanation:

This is the sequence  from glycolysis in which  glucose molecules are split down to pyruvate, to oxidative phosphorylation.

During this process the electrons are released from glucose  molecule as it is oxidised multiple times as pyruvate, and other molecules formed subsequently in Kreb's cycle, until the oxidative phosphorylation is reached .

The makes the  carrier molecules to be reduced.Thus NAD→NADH,FAD→FADH .

The electrons from above are  transferred in hydrogen atoms  to matrix by these co-enzymes.Where the H is split to electrons  and protons.

The electrons for the ETC, produce the PMF for transporting  protons into the intramembrane space.

The concentration of protons generated the electrochemical gradients  which is needed to produce energy for for phosphorylation of ADP with Pi to form ATP by ATpase synthase.

The electrons moves as chain,and this is finally accepted by oxygen as the final electron acceptor.

3 0
3 years ago
Other questions:
  • Mount Everest is the highest mountain in the world. Its peak is at an elevation of 8,848 meters (29,028 feet) above sea level. I
    15·2 answers
  • What are the characteristics of the cell membrane
    11·2 answers
  • Which object in the Solar System is essentially stationary relative to all the other objects in the Solar System?
    7·1 answer
  • Problem attached below.<br> A<br> B<br> C<br> D
    5·1 answer
  • The scattering of a stream of positively charged particles when striking a thin film of gold confirms that
    10·2 answers
  • The layer of the atmosphere that contains the ionsphere is the blank
    9·1 answer
  • Males have only one copy of each type of sex chromosome; therefore, all sex-linked genes are expressed, even recessive alleles.
    13·1 answer
  • A population of squirrels lived together in a forest. An event occurred that caused the population to diverge into two different
    8·2 answers
  • If a ⊥ b and b ∥ c, then _____
    8·1 answer
  • Which one of the following conditions would allow gene frequencies to change by chance? small populations gene flow large popula
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!