1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kruka [31]
3 years ago
12

What is antacid medicine used for?​

Biology
1 answer:
mel-nik [20]3 years ago
6 0

Answer:

to treat heartburn........

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Explain how heredity may have arisen
liraira [26]

By mutation over time of RNA chains

5 0
3 years ago
Read 2 more answers
In fruit flies, a specific gene mutation causes the wings to become malformed. These wings are called vestigial because they do
tamaranim1 [39]

You get VV, Vv, Vv, and vv

3 0
3 years ago
the moon rotating twice in the same amount of time the moon orbit earth once.would you be be able to see the moons far side from
lesantik [10]

Answer:

no the moons far side is well you know FAR so it will be no

Explanation:

i am very sorry if wrong i am just trying to help so i can move on in to ambisous rank

5 0
3 years ago
What is the gel-like fluid that fills the cell and surrounds the organelles?
vivado [14]

Cytoplasm is the gel-like fluid that fills the cell and surrounds the organelles.

7 0
3 years ago
Read 2 more answers
Other questions:
  • 13. What is an example of a carbohydrate?
    8·1 answer
  • 3.
    10·2 answers
  • 1. If a black heterozygous guinea pig is crossed with a homozygous white guinea pig with the
    6·1 answer
  • What difficulties would dubois have faced implementing his program in the south?
    8·1 answer
  • ________ infection is of greatest concern to pregnant women and those with a compromised immune system.
    7·1 answer
  • HELP MEE
    9·2 answers
  • Help plzzzzzzzzzzzzz will give brainliest
    15·2 answers
  • Describe the contributions made by James Watson and Francis Crick and Rosalind Franklin and Maurice Wilkins to the discovery of
    7·1 answer
  • What is the function of the genetic material in the cell​
    11·1 answer
  • 1
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!