1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
2 years ago
14

Enzymes in the saliva begins the digestion of which nutrient ?​

Biology
1 answer:
nasty-shy [4]2 years ago
3 0
Your upper digestive tract and your esophagus also contain smaller clusters of salivary glands. Saliva contains special enzymes that help digest the starches in your food. An enzyme called amylase breaks down starches (complex carbohydrates) into sugars, which your body can more easily absorb.





Please mark me as a brainliest
You might be interested in
Which is a policy designed to reduce water contamination
Ipatiy [6.2K]

Answer:

Treatment of industrial effluents through the extraction of pollutants before discharge to the rivers

Explanation:

Water contamination is the addition of undesirable materials into rivers, lakes and other bodies of water. Polluted water is unclean and unsafe to use therefore policies are designed to reduce water contamination that possesses risk to human health.

8 0
2 years ago
The diagram models how a poison bonds to the active site of an enzyme. Which function is the enzyme most likely unable to perfor
asambeis [7]

The answer is; A

The active site of the enzyme is bound by a substrate and probably the enzyme catalyzes a hydrolysis reaction. The poison mimics the substrate and competes with the substrate for the active site of the enzyme. The poison may bind permanently to the enzyme rendering the enzyme unavailable for other substrates. This could make a particular biochemical reaction, in which the enzyme is involved, to reduce drastically hence threatening life.


3 0
3 years ago
Please help Students made a claim that living things are made of cells, and non-living things are not. Which or these would be t
max2010maxim [7]

Answer:

B or C so they witness it themselves

Explanation:

4 0
3 years ago
Read 2 more answers
An ecologist studying plants in the desert performed the following experiment. She staked out two identical plots, which include
QveST [7]

An ecologist studying plants in the desert performed the following experiment. She staked out two identical plots, which included a few sagebrush plants and numerous small, annual wildflowers. She found the same five wildflower species in roughly equal numbers on both plots. She then enclosed one of the plots with a fence to keep out kangaroo rats, the most common grain-eaters of the area. After two years, to her surprise, four of the wildflower species were no longer present in the fenced plot, but one species had increased dramatically. The control plot had not changed. Using the principles of ecology, propose a hypothesis to explain her results.

Explanation:

  • This example highlights the impact of plant predation on species selection. In the fenced off plot animal predation is not a factor on plant selection.
  • In this case plants will compete for resources only with each other and in this case one plant had a selective advantage over the other 3 species of plants. In the plot exposed to animal predation the ratio of the four species is equal.
  • This is likely do to an increased preference of animals for the plant species that dominates in the fenced off plot and/or anti-animal predation tactics by the other three species.

a.Hypothesis: kangaroo rats are keystone species

-Reintroduce kangaroo rats (and the other locally extinct species)

-Should observe equilibrium re-established

b.Hypothesis: kangaroo rats exert top-down control on community

-Reintroduce kangaroo rats (and other locally extinct species)

-Increase kangaroo rat population in other plot

-Decrease (but don't eliminate) kangaroo rat population in other plot

c.Hypothesis: Locally extinct species inferiorly competed with the extant species of plant

-Remove surviving species from other plot (and remove kangaroo rat population)

3 0
3 years ago
What does free floating DNA mean ?
ivann1987 [24]

Cells with cell chemicals and genetic material having no defined organelles and are all enclosed within a cell wall are called prokaryotes. Organisms in this group are small in size and are mainly bacteria. Ribosomes in these small cells are also small and ‘free floating’.  DNA in prokaryotic cells is in the form of a circular strand and not as a chromosome.

Have an awesome day! :)

6 0
3 years ago
Other questions:
  • Which tool can be used to determine the volume of a metal bolt?
    14·1 answer
  • Describe the importance of biomes such as forests, freshwater, and marine biomes? How have human actions affected these biomes?
    7·1 answer
  • The discovery of mitochondrial DNA (mtDNA) had no effect on which area of scientific investigation?
    12·2 answers
  • 19. The point at which a stream empties into another body of water is the
    14·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Explain how the cell cycle is normally controlled, including reference to the role of tumor-suppressor genes:
    15·1 answer
  • How does carbon dioxide enter the atmosphere?
    6·2 answers
  • Why does low air pressure usually indicate stormy weather?
    13·1 answer
  • In the question about platelets, both a and c are correct, right ?
    8·1 answer
  • Which cell becomes a macrophage when leaving the bloodstream? eosinophil basophil neutrophil lymphocyte monocyte
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!