1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
11

I need help! No links, please!

Biology
1 answer:
ella [17]3 years ago
6 0

it is c

Explanation:

cause it's just c and it will always be c cause I did this before and it was easy so the letter is c and u can correct me if I'm wrong but my mind will always say it's c cause c is my lucky letter so it is c

You might be interested in
A computer runs on a code that consists of only ones and zeros to carry information. How is this similar to DNA?
lys-0071 [83]

Answer:

DNA makes up many genes that are simply turned off and on. It's like ho2 the 1 in binary represented a "on", and the 0 would represent "off".

I hope this helped!

6 0
3 years ago
A characteristic of acids is that they react with metals to: form non-metals release water release hydrogen gas produce bases
astra-53 [7]
<span>  a characteristic of acids is that they react with metals to release hydrogen gas.</span>
6 0
3 years ago
Read 2 more answers
What marine factors affect weather in Jamaica?
goldfiish [28.3K]
<span>The weather on Jamaica is very  hot and humid. The marine factors affect weather in Jamaica is the Atlantic Ocean also Jamaica is on the hurricane belt and that causes  storm damage</span>
5 0
3 years ago
What stage occurs between the 4 cell and 16 cell stage of development
finlep [7]
<span>The product of fertilization is a one-cell embryo with a diploid complement of chromosomes. Over the next few days, the mammalian embryo undergoes a series of cell divisions, ultimately leading to formation of a hollow sphere of cells known as a blastocyst. At some point between fertilization and blastocyst formation, the embryo moves out of the oviduct, into the lumen of the uterus.The images below demonstrate major transitions in structure during early embryogenesis in cattle. Note that in all of the the early stages, the embryo is encased in its zona pellucida. Embryos from other mammals have a very similar appearance, and the general sequence of stages is seen in all mammals.
</span>
6 0
4 years ago
What is a Punnett Square? How can it be used to analyze possible genetic outcomes for offspring?
postnew [5]
A Punnett Square is a chart in which you cross two parents' offspring to figure out what traits their offspring may have.  It helps give an estimate of the probability of the child having different attributes, such as eye color or hair color through the use of dominant and recessive alleles.
4 0
3 years ago
Other questions:
  • X-ray diffraction data collected by Rosalind Franklin and Maurice Wilkins helped Watson and Crick solve the structure of DNA. Wh
    5·1 answer
  • Most mammals have diploid body cells and haploid gametes. During __________, chromosomes from haploid gametes combine, and a ___
    7·1 answer
  • Help with this please
    14·2 answers
  • Diagram what would happen if sexual reproduction took place for four generations using diploid (2n) cells.
    11·2 answers
  • Which is considered a modern space exploration project rather than a historical or future project
    12·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Provide three examples of what to look for in purchasing eggs
    15·1 answer
  • L 1.2.4 Quiz: Severe Weather
    6·2 answers
  • Which cellular structure in plant cells is most responsible for having less flexible animal cells
    9·1 answer
  • Which feature distinguishes protostomes from deuterostomes?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!