1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trapecia [35]
3 years ago
11

Read the passage from "The Quinceanera.” So there I was at the jewelry counter in Ferguson’s department store, surrounded by str

oller-driving moms and crying babies. I had to hurry. Maritza’s party was tonight and, more importantly, I was meeting my friends at the movies at 1:00. It would be the only part of the day I would actually get to enjoy, and I was really looking forward to it. Which phrase from the passage most helps to create the mood? The phrase “stroller-driving moms and crying babies” helps create the irritated mood. The phrase “Maritza’s party was tonight” helps create the anticipatory mood. The phrase “I was meeting my friends at the movies” helps create the playful mood. The phrase “was really looking forward to it” helps create the excited mood.
Biology
2 answers:
Leokris [45]3 years ago
8 0
The phrase "was really looking forward to it" creates the excited mood.
Hope this helps!
maria [59]3 years ago
3 0

Answer: D

Explanation:

You might be interested in
Enter a nuclear equation for the fusion of two h-2 atoms to form he-3 and one neutron. express your answer as a nuclear equation
aliya0001 [1]

The nuclear equation that represents the fusion of two H-2 atoms to form He-3 and one neutron is

\frac{2}{1} h + \frac{2}{1} h >  >  >  >  \frac{3}{2} he   +  \frac{1}{0} n

In a nuclear reaction the nuclides are represented with the chemical symbol preceded by a superscript that represents the mass number (number of protons plus neutrons) and a subscript that represents the atomic number (number of protons).

<h3>What is a Nuclear reaction ?</h3>

A nuclear reaction is a process in nuclear physics and nuclear chemistry where two nuclei or a nucleus and an outside subatomic particle meet to create one or more new nuclides. Consequently, at least one nuclide must change throughout a nuclear reaction.

Learn more about Nuclear reaction here:

brainly.com/question/984564

#SPJ4

6 0
1 year ago
Some organisms undergo asexual reproduction through mitosis, while others reproduce sexually, and their cells undergo meiosis to
Sav [38]
The answer is <span>A. Meiosis: It increases genetic variation, which helps ensure the species will survive.

Meiosis increases genetic variation. This means there is a great variety of genotypes among the population. Hence, there are organisms able to survive in a wider range of temperature. If </span><span>there were drastic changes in temperature in an ecosystem, some of the organisms will survive because their genotype allows them to live in such conditions. If there were no variety thanks to meiosis, all of the organisms would die. And that is not beneficial to a species.
Imagine on the other hand that mitosis occurred. Mitosis does not provide a variety of genotypes and all of the organism will be the same. </span><span>If there were drastic changes in temperature in an ecosystem, all of the organisms would die because all of them could respond to the change in the same way.</span>
5 0
3 years ago
Read 2 more answers
AB
Gre4nikov [31]

Answer:

cos it works on humans better i guess

Explanation:

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
As part of a blood drive on campus for the American Red Cross, you and your friends have just donated 500 ml of blood. You are n
Lunna [17]

D) no change in cardiac output, increased heart rate, decreased stroke volume occurs after blood donation

Explanation:

When a person donates blood, there is a slight loss of blood volume or hypovolemia. This triggers the baroreceptors of the blood; although does not trigger the osmoreceptor.

The baroreceptor responses are according to the arterial pressure which rises momentarily and results in increased sympathetic activity with decreased vagal activity.

These changes will lead to vasoconstriction, reduced stroke volume, increased heart rate or tachycardia which helps to maintain the cardiac output.

The soreness at the venepuncture site on the skin is due to bruising which is common after any needleprick. applying cold pack, elevating and resting the arm.

In order to compensate for the fluid volume loss and avoid dehydration, one must take plenty of fluids before and after blood donation.

8 0
2 years ago
Other questions:
  • Raven is planning a vacation. She wants to go somewhere warm and sunny on her trip because her hometown experiences harsh winter
    6·2 answers
  • Which end product of alcoholic fermentation is important in the baking industry?
    12·1 answer
  • Why is pressure greater in the abyssopelagic zone than in the bathypelagic zone?
    7·2 answers
  • What is the difference between weather and climate
    8·2 answers
  • Animals are multicellular organisms true or false
    5·1 answer
  • 6. To survive, populations of organisms must be able to __<br> offspring
    11·2 answers
  • 10. Deafness in cocker spaniels is inherited. The allele for deafness (d) is recessive to the allele for hearing (D). Two cocker
    13·2 answers
  • The mitochondria function in _____.
    14·2 answers
  • A frameshift mutation is a dangerous mutation because it
    5·1 answer
  • What cell type is the last stage of erythrocyte production prior to development of a mature erythrocyte
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!