1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
2 years ago
5

HEYYYYYYYYYY PLEASE HELP!!!!!

Biology
1 answer:
kodGreya [7K]2 years ago
4 0

Answer:

Velocity

Explanation:

Given the change in positive (direction) over time we are given the velocity formula.

V = Change in direction/Change in time

Since we are given a direction we can rule out speed as well as direction in itself. We can also rule out acceleration because that is the change in Velocity divided by change in time.

You might be interested in
Which sentence describes air pollution?
maria [59]

Answer:

A. Soot and dust is released into the air from the smokestack of a

power plant.

4 0
3 years ago
Read 2 more answers
A scientist is studying genes with complete dominance in flowers. If one parent is homozygous for the dominant gene, what princi
Pani-rosa [81]

Answer:

A. All offspring will be affected by the dominant traits

7 0
3 years ago
The sense of motion in movies is actually created through __________.
sergeinik [125]

Answer:

I believe it is d

Explanation:

8 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
What causes disease in insects
Katena32 [7]

Insects (mosquitoes, lice, fleas, bed bugs) and ticks are able to transmit a number of diseases caused by infectious agents: viruses (chikungunya virus, yellow fever, dengue fever, etc.), bacteria (Lyme disease, plague, etc.), parasites (malaria, sleeping sickness, leishmaniasis, filariasis, etc.)

4 0
3 years ago
Other questions:
  • Which one of the following conditions is an example of resource partitioning?
    9·1 answer
  • What makes a cell or a human unique or different?
    13·2 answers
  • Name a easy planet to do a assignment on not mars
    15·1 answer
  • Select all that apply. Which of the following are functions of stems?
    5·1 answer
  • If a sugar compound has 11 oxygen atoms, how many hydrogen atoms dose it contain
    8·1 answer
  • Wind with the speed of less than 50 km/h is called
    6·2 answers
  • The cell membrane only lets some molecules in and out because it is living. semi-permeable. flexible. non-permeable.
    9·2 answers
  • Where does sound energy go after use
    14·1 answer
  • Is there a difference between plant & animal cells?
    5·2 answers
  • When does the body make most of its nerve cells
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!