1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeu [11.5K]
3 years ago
11

6 g is greater than 600 mg 6 True False

Biology
2 answers:
Allushta [10]3 years ago
5 0

Answer:

True

Explanation:

6g = 6000mg

dsp733 years ago
4 0

Answer:

True

Explanation:

6 grams is equal to 6000 milligrams. Please mark brainiest

You might be interested in
Because it is a cycle, every type of rock goes through all steps of the rock cycle. true false
Harlamova29_29 [7]
No all rock dont have to go through a complete life cycle......i mean some could it but  it dont have to be in any exact order ..... so your answer would be false
6 0
3 years ago
If a reaction in one direction releases energy, the reaction in the opposite direction
RUDIKE [14]
The answer is A , I hope this is not to late
6 0
3 years ago
The essence of meiosis is that a. specialized cell division reduces the chromosome number by half b. gametes are formed that are
marishachu [46]

Answer:

e. a and d are correct

Explanation:

Meiosis produces 4 daughter cells that are haploid. Haploid means they have half of the chromosomes of the parent cell.

5 0
2 years ago
Explain how a girl could have the symptoms of dmd using what you know about inheritance and random mutation ?
Butoxors [25]

well i know this will probally get taken down but ALABAMA jk what cuases dmd is the same genes being in a dna strand so yeah .... i hope this helps

4 0
3 years ago
Read 2 more answers
Does regular exercise reduce the risk of a heart attack? here are two ways to study this question.
exis [7]
Hey there,

Answer:

Exercises such as Anaerobic exercises does help to reduce the risks of heart attack and heart diseases.

Hope this helps :D

<em>~Top♥</em>
3 0
3 years ago
Other questions:
  • A group of scientists wants to test the effects of decreased oxygen levels in the water on a population of albacore. What result
    9·2 answers
  • Explain why species with a diverse gene pool are usually less threatened by environmental change than are species whose members
    9·1 answer
  • Which best describes the result of Mendel's work with pea plants? A. He showed that pea plants do not pass traits to their offsp
    9·2 answers
  • what would occur if the pistil of the flower would not be sticky at the top? what would that mean for the reproduction of the fl
    15·1 answer
  • A learned predisposition to respond cognitively, affectively, and behaviorally to a particular object is known as _____.
    11·1 answer
  • Carbon dioxide with its two double bonds is an example of a polar molecule.
    8·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which structure stores energy for the in the form of ATP?
    5·1 answer
  • Why is there so much oil in the Middle East? Select the best answer from the choices below.
    15·2 answers
  • All living things are made up of building blocks known as ______.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!