1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lara [203]
3 years ago
8

Where will ATPase be found in the mitochondrion? A. in the matrix B. in the inner membrane C. in the outer membrane D. in the in

termembrane space
Biology
2 answers:
ASHA 777 [7]3 years ago
5 0
Im not sure i know its in the membrane, i would have to go with B but i could be wrong 
Triss [41]3 years ago
5 0

Answer:

B. in the inner membrane is the correct answer.

Explanation:

ATPase be found in the inner membrane mitochondrion.

There several types of ATPase F ATPase is present in the inner membrane of mitochondria

ATPases are the kind of enzyme which hydrolysis the ATP to adenosine diphosphate and inorganic phosphate.

function of ATPase it is use to transfer the different types of compounds, ions such as phospholipids other side of the membrane.

You might be interested in
Into which of the following life cycle stages will the sun enter next?
Thepotemich [5.8K]
B) red giant stage

At this stage it will become so big that Earth will be destroyed :(
5 0
3 years ago
Read 2 more answers
What is the approximate time of death if the body temperature was 24°C?
Naddik [55]

Answer:

I think its 1 to 2 days am sorry if am wrong

Explanation:

The equation to solve it is F = C * {9/5} +32

6 0
4 years ago
Acid rain is a major biological concern because it damages both living and nonliving things. true or false
schepotkina [342]
<span>True acid rain is a bio hazard it can hurt many living things. </span>
7 0
3 years ago
Apoptosis is programmed cell death.<br> A True<br> B False
topjm [15]

Answer: true

Explanation:Apoptosis and autophagy are both forms of programmed cell death. Necrosis is the death of a cell caused by external factors such as trauma or infection and occurs in several different forms.

8 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Other questions:
  • Which rocks will likely weather the least? rocks that are soft rocks with a porous surface rocks that are in a dry climate rocks
    14·2 answers
  • For each moleule of glucose that is metabolized by glycolysis and the citric acid cycle, what is the total number of NADH + FADH
    13·1 answer
  • Virus life cycles help please! fill in the blank diagram.
    10·2 answers
  • Glucose does not efficiently diffuse directly through phospholipid bilayers. However, in the digestive tract, large quantities o
    9·1 answer
  • If m || n and the slope of the line m is 3, what is the slope of line n?
    7·1 answer
  • Humans have a gene, T, that is involved in muscle formation of the tongue. Individuals homozygous for one allele can roll their
    10·1 answer
  • A root is absorbing water from the soil. Which route will the water travel inside the root?
    13·2 answers
  • Best explains the process of energy conversion that takes place in the mitochondria
    13·1 answer
  • How are photosynthesis and cellular respiration related
    7·1 answer
  • While walking barefoot along the beach (remember, in pre-pandemic times?), you step on a shard of glass
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!