Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Certain elements are required in large quantities, and others are required in small amounts by the body, but both are essential for the survival of the cells. The cells which are required in large amounts are called as macronutrients, while the ones required in small quantities are called as micronutrients, or trace elements.
Hence, the answer is trace elements or micronutrients.
Answer:
Cristae or Cristal membrane
Explanation:
Cristae is a structure in the mitochondria which is a fold in the inner membrane and its function is to increase the surface area of the inner membrane of the mitochondria, allowing for faster production of ATP
I'd say A because yes they filter water but that has nothing to do with flooding you'd just have filtered flood water.