1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MissTica
2 years ago
9

Someone plz help me :(

Biology
1 answer:
oee [108]2 years ago
6 0

Answer:

I think its C

Explanation:

when the roller coaster is at a high point, it has potential energy but no Kinetic energy but I could be wrong so

You might be interested in
Describe how oil and natural gas compare in terms of predicted supply and carbon dioxide emissions.
Shkiper50 [21]
<span>Pounds of CO2 emitted per million Btu of energy for various fuels: gasoline 157.2, propane 139.0, natural gas 117.0. The amount of CO2 produced when a fuel is burned is a function of the carbon content of the fuel. The heat content or amount of energy produced when a fuel is burned is a function of primarily the carbon (C) and hydrogen (H) content of the fuel. Heat is produced when C and H</span>
8 0
3 years ago
Osmosis is a diffusion process that moves__ through the membrane from higher to lower concentration
Sergeeva-Olga [200]
Molecules through the membrane from higher to lower concentration. 

Osmosis occurs in every one os us and is a very important way of transporting different substances in our body and has drastic implications for our normal, homeostatic functioning. 
8 0
4 years ago
Which of the following represents types of aquatic mammals from most aquatic to least aquatic
Allisa [31]
I would say "B', as polar bears don't actually have to get in water at all!
7 0
3 years ago
Which of the following is true about the Calvin cycle?
Flura [38]

Answer:

The second answer is correct

3 0
3 years ago
Howard m. burgers is a 54-year-old male who is 5' 6" tall, weighs 185 pounds, and has hypertension. the single most effective di
vova2212 [387]

Answer: Reduce his weight

Weighing more than the prescribed Body Mass Index (BMI) and has a hypertension condition is alarming. Mr. Howard must choose to have a healthy lifestyle by eating less sodium and more on fruits and vegetables. The correct selection of food and routine exercise is essential to help reduce his weight and alleviate his hypertension.

5 0
4 years ago
Other questions:
  • My father is type AB and a mother is type O for blood what is the percentage of their offspring that will have type B blood?
    13·1 answer
  • This is a poisonous substance that is produced by living cells or organisms and is capable of causing disease when introduced in
    11·1 answer
  • How do jet streams form?
    12·1 answer
  • Human processes mainly contribute to the
    9·2 answers
  • PLEASE HELP ME!!!!!
    5·1 answer
  • Which is biotic? water temperature beeswax snow
    11·1 answer
  • Which of the following best describes a benefit of studying biology.
    5·1 answer
  • A sample taken from the crime science is called what ?
    13·1 answer
  • in a greenhouse you can control the temperature, light intensity, and carbon dioxide level in order to make it the what factor i
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!