1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
2 years ago
5

which term is the common name of the group whose members are characterized by endoskeleton and a unique water vascular system?

Biology
1 answer:
aliina [53]2 years ago
5 0

Answer:

the Echinoderms.

Explanation:

Examples of echinoderms: starfish, sea urchin, feather stars and sea cucumbers.

You might be interested in
Is made up of prokaryotic cells,<br> Piante<br> O Ribosomes<br> Animals<br> Organelle<br> ?
Bad White [126]

Answer:

Ribosomes

Explanation:

hope that helps and sorry if it's wrong

7 0
3 years ago
Which organizm is most specialized?
ELEN [110]
The most specialized organism is the GRIZZLY BEAR. Specialized animals refers to those animals, which have different types of cells in their body which carry out different types of functions.
4 0
3 years ago
Read 2 more answers
What helps to transport ions,nutrients,and waste
drek231 [11]
The cell membrane helps to transport ions, nutrients, and waste.
8 0
3 years ago
An action potential is caused by an influx of which of these ions into the cell
elena55 [62]
Hey there Sleepope9174,

An action potential is caused by an influx of which of these ions into the cell?

Answer:

Sodium

Hope this helps :D And it would be a great help if you would kindly mark my answer as the brainliest :D Thx ♥

<em>~Danielle♥</em>
5 0
3 years ago
What happens to the matter? How does it transform? What<br> are the inputs and outputs?
Lostsunrise [7]

matter is neither created nor destroyed it only transforms

8 0
3 years ago
Other questions:
  • If hiv first enters the cell in an endocytotic vesicle, instead of directly fusing with the plasma membrane, then
    5·1 answer
  • Which of the following is a phase that results when the moon is on the same side of the earth as the sun?
    7·2 answers
  • I need ans of Q2 and 3 really really quick
    15·1 answer
  • Match the following. Drag and drop each organizational level so that it properly matches up with its description/term. Each term
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • For the body to function normally, the organs and tissues must communicate to control the development of the cells and tissues.
    14·2 answers
  • What type of injury is not likely to occur from a chemical
    5·1 answer
  • 4. Frozen water is less dense than liquid water, Explain why this is important for aquatic
    12·1 answer
  • Which group created a list that would be MOST useful for creating a dichotomous key for this purpose?
    13·1 answer
  • Tell me please help me
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!