1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinvika [58]
3 years ago
14

In thick skin, there is an extra layer of epidermal cells. this layer is called the stratum ______.

Biology
2 answers:
maria [59]3 years ago
8 0

Answer:

stratum corneum

Explanation:

Pavel [41]3 years ago
7 0

Answer: LUCIDUM

Explanation:

You might be interested in
Why are Chongqing, Wuhan, Nanjing, Shanghai and Anqing called the Five Tigers of the Yangtze River?
ra1l [238]

Answer:

Chongqing, referred to as Ba and Yu, also known as Bayu, Shancheng, Yudu, and Qiaodu, is one of the four central municipalities in China, five national central cities, a national historical and cultural city, and the world's hot spring capital; the four major international metropolises positioned by the State Council, the Yangtze River It is the economic center, financial center and innovation center of the upstream region, as well as the center of politics, shipping, culture, science and technology, education, communication, etc., the national comprehensive transportation hub, and the large-scale water, land and air transportation hub in the western region. Chongqing is located in the southwest of China, in the core area of ​​the economic belt in the upper reaches of the Yangtze River, surrounded by the Yangtze River and the Jialing River.

Explanation:

8 0
2 years ago
In the case of a complaint of food-borne illness, the logs for temperature control must be made available to whom?
Tasya [4]

Answer:

the public

Explanation:

anyone who asks for the information should receive it- especially the people who filed the complaint

3 0
3 years ago
Symbiotic relationships between plant roots and fungi are called A. root nodules. B. tendrils. C. mycorrhizae. D. protists.
Shalnov [3]
The answer is C. mycorrhizae.
Hope that helped you.
7 0
4 years ago
Read 2 more answers
Which three of the following are examples of feedback mechanisms which help maintain homeostasis?
vladimir2022 [97]
D. Insulin secretion in response to high blood sugar.

Homeostasis can be described as a tendency of living organisms to maintain a state of stable internal environment. In other words, it is the tendency to resist any change in the optimal conditions for survival.
It is brought by several regulatory mechanisms in the body such as regulation of body temperature, regulation of pH, regulation of osmolarity etc.
4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • If you hear that a cold front is headed for your area, what type of weather might you expect
    6·2 answers
  • Please hurry :) please
    13·1 answer
  • 35. Which of the following macromolecules are correctly matched with their subcomponents?
    13·2 answers
  • Which anatomical description is true of the parasympathetic division of the autonomic nervous system?
    11·1 answer
  • What biochemicals both enter and leave a leaf
    7·1 answer
  • Identify the type of factor (environmental, pathogen, or genetic) or combination of factors that causes each of the following di
    7·1 answer
  • Frogs have developed some adaptations to survive in their environment. Match the adaptations to the benefits.
    15·2 answers
  • Crude oil goes through ________ to separate the parts by weight.
    5·1 answer
  • The combining form cutane/o-,as in the word subcutaneous,means ________.
    15·1 answer
  • Which of the following statements below are TRUE about Keystone Species? Pick all that are correct
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!