Revise this sentence by replacing all gerunds with infinitives.

Biology

1 answer:

vekshin14 years ago

5 0

Answer:

Please see below

Explanation:

I always tell people that I love to dance, to write and to paint.

The verb keep cannot take an infinitive afterwards so it is better to replace that expression altogether with another one that means the same thing, but that can use an infinitive. The verb love can take either gerunds or infinitives afterwards with only a subtle variation in the meaning.

You might be interested in

Which of the following is not part of the cell theory?

AVprozaik [17]

D. There are three parts of the cell theory and this one is never stated.

7 0

4 years ago

Read 2 more answers

The channel proteins ____ allow water to move into/out of a cell due to ____.

labwork [276]

Most of the time, water is moved through osmosis

4 0

3 years ago

Read 2 more answers

Help please with 11 and 12

d1i1m1o1n [39]

Santa Claus is coming to town Santa Claus is coming to town Santa Claus is coming to town on Santa Claus is Coming to Town drugs drugs drugs AAA locator who is subliminally the eastern half of the Byzantine empire state building is so pretty eyes of the Roman empire became known as the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the eastern half gjrkejfbfujrbdu I know i need to lose weight fast free apps that she uses on her phone and I just quit the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the eastern half of the Roman empire became known as the eastern half of the Roman empire became known as the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the eastern half of 6th 6666jgjejenfuehfhrbfje7rjr then did uhu e and he mistreats her and I just quit the teacher apologise for the eastern district court judge has a new musically the eastern half of the empire became known as the eastern half of 6th and I just quit the eastern half of the empire

6 0

3 years ago

Please explain in detail! thanks!!

quester [9]

Answer:

it acts as the site that RNA polymerase will bind, after which transcription proceeds

Explanation:

promoter assist in making mRNA, mRNA is a template which allows complimentary base paring to occur to form protein

6 0

3 years ago

I need help in class, I have one more to finish! Pls, help me, guys!

Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0

3 years ago