D. There are three parts of the cell theory and this one is never stated.
Most of the time, water is moved through osmosis
Santa Claus is coming to town Santa Claus is coming to town Santa Claus is coming to town on Santa Claus is Coming to Town drugs drugs drugs AAA locator who is subliminally the eastern half of the Byzantine empire state building is so pretty eyes of the Roman empire became known as the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the eastern half gjrkejfbfujrbdu I know i need to lose weight fast free apps that she uses on her phone and I just quit the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the eastern half of the Roman empire became known as the eastern half of the Roman empire became known as the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the eastern half of the Roman empire became known as the teacher apologise for the eastern half of 6th 6666jgjejenfuehfhrbfje7rjr then did uhu e and he mistreats her and I just quit the teacher apologise for the eastern district court judge has a new musically the eastern half of the empire became known as the eastern half of 6th and I just quit the eastern half of the empire
Answer:
it acts as the site that RNA polymerase will bind, after which transcription proceeds
Explanation:
promoter assist in making mRNA, mRNA is a template which allows complimentary base paring to occur to form protein
Answer:
If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT
If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU
Explanation: