Well, (not trying to plagiarize) the client is expressing their fear of surgery, and this is from the body's reaction to danger (emotionally and physically).
Answer:
Living
Explanation:
To function the brain send out signals to optimize and regulate the body and that's what makes you a living organism
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Here you need to put if you have any questions about the material you are learning. If you have none i would consider putting that you have none.
