1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hatshy [7]
3 years ago
11

Zeke has already written 1 page, and he expects to write 1 page for every additional hour

Mathematics
1 answer:
pshichka [43]3 years ago
6 0

Answer:

50

Step-by-step explanation:

49 hours *1 page =49 pages

49 pages+1 page= 50 pages

Hope this helps! :)

You might be interested in
Please help with this exercise.
algol [13]

for the lines k (x) = (- 9 / 5) x + (5 / 2) and h (x) = (2 / 5) x - (7 / 6), the solution for x will be 5 / 3 and y will be - 1 / 2.

We are given the two lines:

k (x) = (- 9 / 5) x + (5 / 2)

h (x) = (2 / 5) x - (7 / 6)

At the intersection of the two lines, we get that:

(- 9 / 5) x + (5 / 2) = (2 / 5) x - (7 / 6)

(2 / 5) x + (9 / 5) x =  (5 / 2) + (7 / 6)

(11 / 5) x = 11 / 3

3 x = 5

x = 5 / 3

y = (2 / 5) (5 / 3) - (7 / 6)

y = 2 / 3 - 7 / 6

y = - 1 / 2

Therefore, we get that, for the lines k (x) = (- 9 / 5) x + (5 / 2) and h (x) = (2 / 5) x - (7 / 6), the solution for x will be 5 / 3 and y will be - 1 / 2.

Learn more about lines here:

brainly.com/question/24644930

#SPJ1

6 0
1 year ago
What is the value of 1 x ÷ 5, when x = 80? enter your answer in the box.
slava [35]
Insert 80 into the equation
1(80) / 5
80/5 = 16
7 0
3 years ago
Read 2 more answers
If Michael invests $2000 in the bank at a rate of 5.5% for 6 years how much interest will he make?
Natalija [7]

Answer:

intereste = 660

Step-by-step explanation:

interest \:  =  \frac{2000 \times 5.5 \times 6}{100}  \\  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \: =  \frac{66000}{100}  \\  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  \:  = 660 \\

plz..

mark it as a brilliant answer

8 0
3 years ago
Segment addition with variables
oksian1 [2.3K]

<em>x equals 22</em>

<h2>Explanation:</h2>

____________________________________________

The Segment Postulate states the following:

<em>Given two end points A and B, a third point C lines on the segment AB if and only if the distances between the points satisfy the equation:</em>

\overline{AB}=\overline{AC}+\overline{CB}

____________________________________________

From the figure:

\overline{AC}=8+x \\ \\ \overline{CB}=10 \\ \\ \overline{AB}=40

Our goal is to find x:

\overline{AB}=\overline{AC}+\overline{CB} \\ \\ Substituting \ values: \\ \\ 40=(8+x)+10 \\ \\ 18+x=40 \\ \\ Subtracting \ 18 \ from \ both \ sides: \\ \\ 18-18+x=40-18 \\ \\ \boxed{x=22}

<h2>Learn more:</h2>

Dilation: brainly.com/question/2501119

#LearnWithBrainly

4 0
2 years ago
Need help plz
nasty-shy [4]

Answer:

Z

y

x

Step-by-step explanation:

zy

xz

xy

5 0
3 years ago
Other questions:
  • Given that f(x)=2x+1 and g(x)=-5+2, solve for f(g(x)) when x=3
    11·1 answer
  • HELP ASAP MATH QUESTION WILL BE MARKED BRAINLIESTTT!!
    7·2 answers
  • a mail order company charges 4 1/2 % for shipping and handling for all orders if the total form order is 54.34 how much is the t
    15·1 answer
  • Someone listed all the numbers from 0 to 99999 in increasing order. Then he crossed out all the numbers where some other digit(s
    9·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Need some help please
    15·2 answers
  • NEED HELP ASAP!!! Which of the following shows the prime factorization of 72 using exponential notation?
    9·1 answer
  • Let's say you are in the market to buy a car that will cost you $20,000. Shopping around for financing, you manage to get $20,00
    7·1 answer
  • Question 7 of 10<br> Evaluate the expression and enter your answer below.<br> V64<br> v4
    14·2 answers
  • Name the degree of the monomial. -10x^(4)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!