1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirza4 [7]
2 years ago
6

What is the biggest job that nucleic acids have

Biology
2 answers:
Komok [63]2 years ago
5 0

Answer:

the biggest job DNA and RNA have it making protein which are found inside the cell

Anna11 [10]2 years ago
4 0

basically the main function of a nucleic acid is to carry your biological information.

You might be interested in
8. In a population of beetles, there is a gene for color with two codominant alleles. The allele R leads to red beetles and the
Eddi Din [679]

Answer:

The genotypic frequency = 1:1

The phenotypic frequency = 1:1

Explanation:

Given that:

The allele → R = Red beetles

The allele → B = Blue beetles

Since the gene color shows a codominant allele

The Red Beetle = RR

The blue beetles will be = BB

The heterozygous beetle will be = RB

∴

The punnet square showing the crossing of RB × RR is:

                R                   B

R                RR               RB

R                RR               RB

The result shows that we have two red beetles and two heterozygous beetles.

Hence;

The genotypic frequency = 1:1

The phenotypic frequency = 1:1

8 0
2 years ago
What would happen if dna was not condensed into chromosomes during mitosis?
natta225 [31]
The answer of the question is A
3 0
3 years ago
Read 2 more answers
Coal formation is largely the result of _____.
Nookie1986 [14]

Answer:magma

Explanation:

4 0
2 years ago
An ecosystem includes all of the living and nonliving factors in a given area. That is, it includes all of the organisms (e.g.,
anastassius [24]

The amount of available resources in the ecosystem must change at a predictable rate.

8 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • What causes a mountain breeze?
    6·2 answers
  • In addition to identifying the genetic material, the experiments of Avery, MacLeod, and McCarty with different strains of Strept
    8·1 answer
  • State one reason why the cane toads were important to Australia
    9·1 answer
  • In what ways did the Nazis violate the Treaty of Versailles in the 1930s? Check all that apply.
    12·1 answer
  • How do the organ systems function together in the human body?
    8·1 answer
  • Liz is examining a plant cell under a microscope. She sees many small green strutures inside the cell. Her teacher explains that
    14·2 answers
  • HELP PLEASE!! it’s about nutrition!!
    15·1 answer
  • What animal group lacks true tissues and includes species that are asymmetrical
    9·1 answer
  • The graph demonstrates the quantitative variation for skin pigmentation.
    9·1 answer
  • Passage of peptides through the blood-brain barrier with colloidal polymer particles (nanoparticles). Brain Res 1995, 674 (1), 1
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!