1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antoniya [11.8K]
2 years ago
8

What could a dog living now and a cat living thousands of years ago have in

Biology
2 answers:
bazaltina [42]2 years ago
7 0
D. They have the same amount of energy.
iogann1982 [59]2 years ago
6 0

Answer:

a-they have the same bone structue

Explanation:

hope it helps

You might be interested in
Which sociological perspective would highlight the reluctance among professional athletes to display any sexual identity other t
netineya [11]

Answer:

Answer is queer theory.

Explanation:

Queer theory is a theory that was formulated towards the sexual minorities. These sexual minorities are those with the act of having sexual relationship with the people of their gender or sex. This is called homosexuality.

This theory portray them as abnormal or strange people in the society, thus making them to hide their sexual identity.

In this sense, professional athletes normally display heterosexuality as their sexual identity to avoid this notion of queer theory.

Note that, heterosexuality is the sexual attraction or behavior to the person of opposite sex, e.g sexual attraction between a man and a woman.

6 0
3 years ago
Which of the following is a species? <br> A. Giant Pandas<br> B. Horses<br> C. Humans<br> D. Rabbits
sasho [114]
I would guess giant pandas because they aren't referring to a regular panda. giant pandas are a type of panda that live in Asia. then there are other types too. my second guess would be humans just because there are no other "species" or type of human but the pure form of human.
3 0
3 years ago
Read 2 more answers
Two reasons why many cases of abuse and violence are not reported
Pavel [41]
The kid is jumped and beat up from some bullies at school, he may be afraid that they will beat him again worse if he tells on them. <span>Fear of retribution.</span>
8 0
3 years ago
Read 2 more answers
The correct order of movement of proteins through the golgi apparatus is
ziro4ka [17]

Answer:

rough ER → ER-to-Golgi transport vesicles → Golgi cisternae → secretory or transport vesicles → cell surface (exocytosis)

Explanation:

Proteins go through the secretory pathway.

6 0
3 years ago
Chemical reactions that release energy
Alik [6]
The answer is B.hope this helps
8 0
3 years ago
Other questions:
  • Object A and Object B are 100 meters apart. If Object A gains some mass, how does that affect the gravitational force between th
    10·1 answer
  • If an enzyme in solution is saturated with substrate, the most effective way to obtain a faster yield of products is to
    13·1 answer
  • Bioinformatics can be used to scan sequences for probable genes looking for start and stop sites for transcription and for trans
    5·1 answer
  • How is it posibal to have ionic and covalent bonds
    9·1 answer
  • What are the genotypes of these flies?
    12·1 answer
  • What is the mesentery of a frog
    9·1 answer
  • If 1250 J of work is done on an object that weighs 50 N, how far can that<br> object be raised?
    6·1 answer
  • When a living thing changes in response to a change in seasons, it is called a ________.
    14·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Informational text about the food chain
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!