1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
3 years ago
12

5(a+4)-6a+1=12 plz help its due today

Biology
2 answers:
irga5000 [103]3 years ago
3 0

Answer:

a = 9

Explanation:

5(a + 4) - 6a + 1 = 12

5a + 20 - 6a + 1 = 12

5a - 6a + 20 + 1 = 12

-1a + 21 = 12

     -21      -21

--------------------------------

-1a = -9

/-1     /-1

---------------------------------

a = 9

USPshnik [31]3 years ago
3 0

Answer:

a = 9

Explanation:

the steps are in the answer above me

You might be interested in
What do restriction enzymes do to the DNA?
Nostrana [21]
Restriction enzymes are DNA cutting enzymes found within bacteria. They can cut the DNA molecule.
7 0
3 years ago
Read 2 more answers
Ruth is presenting the feedback model to her class help her complete the statements
Rudik [331]

Answer:

Feedback models are tools that provides specific, concise, and clear feedback for a particular thing.

Explanation:

Feedback models are tools that provides specific, concise, and clear feedback for the organization so that an organization can make useful changes which is necessary for the organization growth and development. There is high need of this feedback model which helps us to know about the specific areas where one needs to improve performances in order to work more effectively.

5 0
3 years ago
A county commission is considering assessing a tax on residential water use above a certain amount. What might this tax be tryin
Alex_Xolod [135]
A. 

The aim of a tax on a valuable resource, in this case residential water use, is to reduce wasteful practices. In this case the county is considering a special tax when residential water use is ABOVE a certain amount. This is an effective mechanism to reduce wastage by causing high users to incur more cost. Everyone will still pay for their water consumption in the normal way (typically by a $/unit cost), however the tax will take effect when the residential water consumption reaches a certain point. This penalises high users of water by forcing them to pay more for a valuable resource. Note that essential services like energy and water are often subsidised in society. This means that we do not pay the true cost associated with the use of the resource. Setting a tax that applies to those that consume over a certain threshold helps to reduce wastage of an undervalued essential resource such as water or energy.
6 0
3 years ago
Read 2 more answers
using the diagram below, identify TWO structures used in membrane transport and explain how they help that to occur
Novay_Z [31]

Answer:

The two structures used in membrane transport are 1 integral membrane protein 2 peripheral membrane protein.

Explanation:

The various protein present in the plasma membrane help the later to exhibit its function to transport various solute molecules and ions across the membrane.

      Integral membrane protein such as Na+K+ATPase helps in the transport of Na+ ions inside the cell and K+ ions outside the cell against their concentration gradient.

 Peripheral membrane proteins are present in water soluble region of either extracellular region or cytoplasmic region or both.Peripheral protein also helps in the transportation of various solute molecules .

8 0
3 years ago
how does drooping the sticks on the table and transcribing the letters on the sides facing up follow mendel's law of segregation
scoray [572]

Answer:

Drooping the sticks on the table and transcribing the letters on the sides facing up follow Mendel's law of segregation​ by showing the segregation determining which alleles end up in the gamete.

Explanation:

  • The Mendel's law of segregation states that the allele pairs always separate and segregate at gamete formation process and they randomly unite at the fertilization.
  • When fertilization process is carried, the new organism developed has multiple factors for each trait, one from each parent.
  • So the bending or drooping of the sticks and transcribing letter follows that law proposed by Mendel in 1860s.
  • This law is also commonly known as the purity of gametes.
4 0
3 years ago
Other questions:
  • Consider the operon in model 1. other than the gene that regulates the operon, how many genes are contained within the operon?
    13·1 answer
  • How might climate change affect species on earth​
    5·1 answer
  • Most organisms obtain energy from food by the process of cellular respiration. Which is the most likely explanation for what pre
    8·1 answer
  • What waste product do yeast produce under anaerobic conditions?
    8·1 answer
  • Gravity is the primary force responsible for____
    9·1 answer
  • Which of the following happens when cancer occurs?
    10·1 answer
  • Who some people leave their homes in Mexico
    5·2 answers
  • Consider the following situation carefully:
    12·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Nhận định nào sau đây, ĐÚNG với cách di chuyển của giun đất
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!