1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
7

If fission takes place every 20 minutes in some bacteria, then starting with one bacterial, how many bacterial cells would be pr

oduced in three cell divisions or one hour

Biology
1 answer:
bixtya [17]3 years ago
4 0
There would be 8 bacteria

You might be interested in
Chemicals extracted from certain sponges have been used in the treatment of cancer patients. Which of the following could be con
inessss [21]

Answer:

All responses are correct  

Explanation:

1- This process of chemical extraction produces release of toxins that are toxic to other life forms

2- Sponges are critical organisms in the nutrient cycles

3- Sponges provide habitat for other species (fish, crustaceans, etc)

4- Sponges have the ability to regenerate when they are separated into pieces  

8 0
3 years ago
Read 2 more answers
Question is in the image below.
olchik [2.2K]

Answer:

It's the last one

Explanation:

The grand canyon was formed by erosion of water. That is the only option with erosion of water for the grand canyon

8 0
3 years ago
Read 2 more answers
Charles darwin noticed that finches on different islands of the galapagos islands were similar but that their beaks differed. wh
EleoNora [17]
<span>Charles Darwin notices that finches on different islands of the Galapagos Islands were similar but that their beaks differed. What
explanation for these differences did he propose?</span><span>
Answer: (A.)., The beaks of the finches are adapted to the way the bird usually gets food.</span>
7 0
3 years ago
How many chromosomes would a typical human cell have after mitosis but before cytokinesis?
timama [110]
I believe the correct number of chromosomes is 92.
Mitosis is the type of cell division that takes place in the somatic cells in which a parent cell divides into two diploid daughter cell with 46 chromosomes each. Cytokinesis is the process in which the cell divides into two cells after mitosis, therefore a cell that has not undergone cytokinesis will have 46 ××2 chromosomes. 
8 0
3 years ago
An article in the local paper is discussing a new copper mine in New Mexico. It states that all that is needed to identify a sub
JulijaS [17]
The answer is incorrect so it is either C or D
8 0
3 years ago
Read 2 more answers
Other questions:
  • A diet rich in fiber and fluids would be most beneficial for people with __________. A. constipation B. diabetes C. high blood p
    11·2 answers
  • A rooster with gray feathers is mated with a hen of the same phenotype. Among their offspring, 15 chicks are gray, 6 are black,
    15·1 answer
  • Where does the mutation occur that eventually can lead to cancer in a person?
    14·1 answer
  • Do bigger organisms have bigger cells what kind of test could you do to answer this
    10·2 answers
  • Which is the term for a drug that increases the activity of the nervous system?
    9·2 answers
  • Which is not a potential threat or danger to ecosystem rich <br> in bio diversity
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Below is a carrying capacity graph of a meerkat population in an African savanna. Meerkats are omnivores and eat a variety of or
    8·2 answers
  • the enteric nervous system is a network of neurons found throuout the wall of thoracic orgsns such as the lungs. true or flase
    7·1 answer
  • What is the significance of black eyed peas and cabbage for new years
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!