1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
2 years ago
15

Which forms of transport across a cell membrane do NOT require the use of ATP?

Biology
1 answer:
lesya692 [45]2 years ago
6 0

Passive transport is the movement of substances across the membrane without the expenditure of cellular energy.

You might be interested in
Overfishing of (blank)
sweet [91]

Answer:

Overfishing can have an adverse effect on marine biodiversity. ... Overfishing can wreak havoc and destroy the environment and marine ecology and completely disrupt the food chain. For example, herring is a vital prey species for the cod. Therefore, when herring are overfished the cod population suffers as well.

Explanation:

3 0
3 years ago
All birds lay their eggs on land.
bixtya [17]
B just specialized beaks pls put the answer like Brainly answer
5 0
2 years ago
Which of these correctly shows ecological succession in a lava field?
larisa [96]

The ecological succession that occurs in a lava field is as follows:

  • Moss and lichen arrive by birds to barren lava field.
  • Soil is created.
  • Fountain grass grows.
  • Monkeypod trees grow.

<h3>What is ecological succession?</h3>

Ecological succession refers to the series of changes that occur in a habitat gradually with new species replacing existing species or a barren habitat until the environment becomes more complex.

A lava field is a barren field where there are no species

The ecological succession that occurs in a lava field is as follows:

Moss and lichen arrive by birds to barren lava field; Soil is created; Fountain grass grows; Monkeypod trees grow.

Learn more about ecological succession at: brainly.com/question/18240055

7 0
2 years ago
El encargado de materiales de su grupo debe ir a recoger los materiales.
Bas_tet [7]

Answer:

todos deben tener los materiales por si a alguien se le olvida un material

tu se lo prestes

Explanation:

por que es en equipo

3 0
2 years ago
8 Sentences describing Nature vs. Nurture. <br> Please Need Help Asap
VikaD [51]
Nature is genes. Nurture is how someone or something is grown/ raised. Scientists believe both are important, so they do not choose one over the other.

I hope this helps.
4 0
2 years ago
Read 2 more answers
Other questions:
  • If a population of deer exceeds its carrying capacity, it is likely that the
    5·2 answers
  • During what period are kcalorie needs per unit of body weight the highest
    14·1 answer
  • Glycolysis is the process of converting glucose into pyruvic acid. Where does this process occur?
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Why is it important that cells have a contrllol system to regulate the timing of cell division
    13·1 answer
  • Round seeds and yellow seed color are dominant to wrinkled seeds and green seed color. What is the probability of having offspri
    10·2 answers
  • In scientific notation, a number is expressed as a value between 1 and 10
    8·1 answer
  • Helpppppp me plz and please make these answer right please TnT
    7·1 answer
  • Which statement best differentiaates between weather and climate
    12·1 answer
  • Whales, birds, snakes, and fish need oxygen to survive. Even though they share this trait, these animals are not related because
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!