The reaction of a particular endothermic reaction whether in a negative or positive entropy change is always spontaneous. Temperature differences will be spontaneous throughout the reaction but one thing is constant, heat will always be produced within the said reaction.
You use your lungs to take deep breaths and it calms all your nerves
HOPE THIS HELPS
[[I play roblox my account is -----> XxfireheartdragonxX
Answer:
Hawks
Explanation:
As you go up in the trophic levels, energy is converted into heat energy. I recommend that you read about the 10% rule
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
It- damages the DNA in skin cells and produces genetic defects that can lead to cancer.