1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
12

Ý nghĩa của cách viết sau 3 Ca

Biology
1 answer:
Alexus [3.1K]3 years ago
5 0

Explanation:

what is april?? co.me he.re

qvuutrksra

You might be interested in
What can be said about an endothermic reaction with a negative entropy change? the reaction is what can be said about an endothe
zimovet [89]
The reaction of a particular endothermic reaction whether in a negative or positive entropy change is always spontaneous. Temperature differences will be spontaneous throughout the reaction but one thing is constant, heat will always be produced within the said reaction.
7 0
3 years ago
Feeling a little stressed? you take a few deep breaths and calm down what nerve​
lara [203]

You use your lungs to take deep breaths and it calms all your nerves

HOPE THIS HELPS

[[I play roblox my account is -----> XxfireheartdragonxX

6 0
3 years ago
In the food web the trophic level with the least energy includes which of the following organisms?
Hoochie [10]

Answer:

Hawks

Explanation:

As you go up in the trophic levels, energy is converted into heat energy. I recommend that you read about the 10% rule

6 0
2 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Ultraviolet (UV) radiation is damaging because it __________. View Available Hint(s)for Part A prevents DNA transcription preven
Lemur [1.5K]
It- damages the DNA in skin cells and produces genetic defects that can lead to cancer.
7 0
2 years ago
Other questions:
  • The passing of __________________ is the basis of heredity. 2. our ________________ encode the instructions that define our trai
    13·1 answer
  • A proposed theory in the history of evolution where prokaryotic cells engulfed aerobic heterotrophic prokaryotes and photosynthe
    6·1 answer
  • Read the following title: Lines Composed a Few Miles Above Tintern AbbeyWhat type of information does this title most likely giv
    5·1 answer
  • What are examples of harmful mutations
    11·1 answer
  • Which plant has largest pollen ​
    10·1 answer
  • Excluding the stop codon, the coding sequence consists of 1533 nucleotides. How many amino acids will this translate into?
    13·1 answer
  • Pls help question is in picture
    14·2 answers
  • Dogs are a result of which of the following processes?
    13·1 answer
  • A buried body of shale is subjected to differential stress, causing clay minerals to realign and produce slate. This is an examp
    8·1 answer
  • Pioneer organisms are the first organisms to reoccupy an area, which has been disturbed by a disruption. Typical pioneers in a s
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!