1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadya68 [22]
3 years ago
10

Where is the energy in a polysaccharide stored?

Biology
2 answers:
kkurt [141]3 years ago
8 0

Answer:

You store it: Glycogen

Explanation:

Excess glucose is stored in the liver as the large compound called glycogen. Glycogen is a polysaccharide of glucose, but its structure allows it to pack compactly, so more of it can be stored in cells for later use.

Brums [2.3K]3 years ago
4 0

Answer: Glycogen so the other person is right

Explanation: so give the other person brainlist

You might be interested in
Can some one help me plz
Svetradugi [14.3K]
Number 6 is D, However Number 7 is not humus. They are contributing to the formation of silt. Which is kind of like a fertilizer.
7 0
4 years ago
what is viscosity and what effect does heat have on the viscosity of DNA? What is the underlying cause of the change?​
tino4ka555 [31]

Answer:

Please find the definition of viscosity, effect of heat on DNA explanation to this question below

Explanation:

Viscosity is a term used to describe FLUIDS, which includes liquids and gases. Viscosity refers to the ability of a gas or liquid to resist flow. In other words, it is the measure of the internal friction that exists between the molecules of a fluid, which resists its flow.

DNA in its natural state exists in a liquid solution, hence, when HEAT is applied, the heat causes ITS MOLECULES to MOVE RELATIVELY FAST and as a result the molecules lose the friction between them and begin to flow. Based on this, heat is said to make DNA LESS VISCOUS i.e. to flow more rapidly.

3 0
3 years ago
Which part of the photoreceptors contain the photo pigments?
RUDIKE [14]
There are 2 types of photoreceptors rods and cones they react to light in different ways.

Rods-
Respond to low levels of light and are primary responsible for night vision.
They are poor at detecting fine details in an image and are not involved in colour vision.

Cones-
Respond to high levels of light and are primary responsible for our vision in well-lit conditions.
They detect fine details and are responsible for colour vision.
7 0
3 years ago
Unlike the carbon cycle the phosphorous cycle does not involve
sertanlavr [38]
Unlike the carbon cycle, the phosphorous cycle does not involve a gas phase and is therefore not considered as a true cycle. This is what distinguishes it also from such cycles as the water and nitrogen cycles. Very little phosphorous circulates in the atmosphere because at earth's normal temperatures and pressure, phosphorous together with its various compounds are not in gaseous form, though small amounts of phosphoric acid may make their way into the atmosphere, and contributing to acid rain in some cases. The largest reservoir of phosphorous is in sedimentary rock.
4 0
3 years ago
Some antibiotics can harm the ribosomes in animal cells. Which of the following would you predict to be the most likely long ter
dlinn [17]
Likely if you harm the ribosomes the cell will die. Cells absolutely require ribosomes for normal functioning...they are constantly replacing proteins (including enzymes and the ribosomal proteins) to keep alive.
7 0
4 years ago
Read 2 more answers
Other questions:
  • To be considered a living thing an organism must be able to
    11·1 answer
  • What is humidity. A: the amount of water vapor per a unit of air. B: the amount of water vapor in the air at a given time and pl
    10·2 answers
  • Synonym of genotype and definition
    15·1 answer
  • Select the best example of transgenerational epigenetic inheritance.A-Individuals with a history of childhood abuse have more me
    14·1 answer
  • A pond containing fish, frog, ducks, and lily pads is affected by pollution. What statement describes the animals that are most
    15·2 answers
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • 4. If a mother and father are both heterozygous for Brown hair (B) over blond hair (b), what will their offspring look like? ​
    5·1 answer
  • Assuming independent assortment for all gene pairs, what is the probability that the following parents, AABbCc × AaBbCc, will pr
    9·1 answer
  • Which organelle is found in photosynthetic organisms and captures energy from the sun?Which organelle is found in photosynthetic
    5·2 answers
  • traits that are shared by more than one member of a group because of common ancestry are known as: alternative character states.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!