1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
meriva
3 years ago
15

If a doctor knows that a cat has an eye disease but is unsure of the cause, the doctor chooses the drug

Biology
1 answer:
konstantin123 [22]3 years ago
8 0
True false question?

If so think its true
Hope this helps
You might be interested in
The flow of energy in an ecosystem is best
melamori03 [73]
The flow of energy in an ecosystem is best described as energy moving in one direction from the sun to the producers then to the consumers. 

Explanation; 
Energy flow is the amount of energy that moves through successive trophic levels of a food chain in an ecosystem. Ecosystem maintain themselves by cycling energy and nutrients.
The energy from sunlight is taken up by producers which use it to produce organic compounds through photosynthesis. The energy is then passed successively to the trophic levels, that is from the producers to the consumers ( primary, secondary, tertiary and quotienary consumers). During this transfer some energy is lost at each trophic level in form of heat. 
4 0
3 years ago
Read 2 more answers
HELP!!!
PIT_PIT [208]

Answer: C). Extraction

Explanation:

Minerals are the inorganic susbtances obtain from the under surface of the earth crust. They are collectively found in the geosphere of earth.

The mineral formation is a long geomorphic process it does not involve any biological activity. After mineral formation mineral extraction is the next step in the resource cycle.

The extraction process involves mining techniques.

3 0
3 years ago
What climate change solution gave you the most hope for our future? explain why!
liq [111]

Answer:

Changing energy to clean energy. This solution gave me some hope because we would stop using non-renewable resources, which are harmful to the environment.

5 0
2 years ago
One of the functions of cholesterol in animal cell membranes is to
DerKrebs [107]
I think its letter e.
3 0
3 years ago
When Jacob is running, his heart beats 23 times in 10 seconds. What is Jacob's heart rate in beats per minute (bpm) while runnin
Alika [10]
138 bpm 2.3 x 60 is 138
6 0
3 years ago
Read 2 more answers
Other questions:
  • How do plants respond their environment
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The ________ functions in the control of movements of the upper legs and the trunk. corticobulbar pathway rubrospinal tract late
    11·1 answer
  • A mutation may cause a change in the genotype of a trait? <br><br> True or false
    14·1 answer
  • Which adaptation would be most beneficial of both the taiga and marine aquatic biomes
    6·2 answers
  • What is the anaerobic breakdown of glucose called?
    8·1 answer
  • What is the effect of Sunlight, carbon dioxide,<br> water vapor, methane
    10·2 answers
  • Which of the following is NOT a function of the digestive system?
    11·2 answers
  • 2. Tim and Stephanie are devastated when the
    15·1 answer
  • 1 State whether the following statements are True or False.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!