1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
13

Please help just one question.

Biology
1 answer:
snow_tiger [21]3 years ago
8 0

Answer: I think the answer is True

You might be interested in
Which statement about organism classified in the same genus is true?
notsponge [240]

Genus represents taxonomic rank above species and below family. When organisms belong to the same genus, they must be of the same phyla, but may be in different species. In binomial nomenclature it is the generic name shared by the group of close relative.

7 0
3 years ago
Read 2 more answers
Explain the most common machine in the human body
Ilya [14]
HI there!!!!!!

It would probably be the heart, brain or our muscles; they are constantly working !

5 0
3 years ago
Which of the following is a constructive process?
Oduvanchick [21]

Answer:

Deposition is a constructive process.

Explanation:

A positive method relates to a mechanism requiring the creation of a single entity or element.

Sediments can be soil or rock formed. Weathered materials which are carried through sheets probably led to a forming of the shape of the soil through influences such as wind , water, gravity, etc.

Answer: Deposition

<em><u>Hope this helps.</u></em>

4 0
3 years ago
There is modified interphase between meiosis I and meiosis II in which chromosomes are duplicated.
Norma-Jean [14]

Answer:

come on yu can do thi you just need to try a little harder and stop asking us to answer all your questions just try.

Explanation:

7 0
3 years ago
Select the correct answer.<br> Which of these is a protein?
shusha [124]
Um i don’t see anything
6 0
4 years ago
Other questions:
  • What are two of the products of the Krebs cycle
    13·2 answers
  • Safety Equipment Checklist
    8·1 answer
  • The bed alarm is ringing because an older adult client is attempting to get out of bed. a nurse enters the room and finds the cl
    14·1 answer
  • The rusty crayfish is harmful to native species of crayfish because it clear cuts the bottom of waterways leaving native species
    8·2 answers
  • Suppose that the central c-g base pair in the dna molecule below is substituted by an a-t base pair. what is the most likely res
    10·1 answer
  • 10. Which is(are) correct regarding DNA?
    13·1 answer
  • What keeps the cell membrane from collapsing
    15·1 answer
  • Predict the chemical formula of butyne, having one carbon-carbon triple bond.
    15·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Help!!! How do you feel about the idea of using CRISPR and other genetic modification technologies on humans? Is this a good ide
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!