1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nevsk [136]
3 years ago
11

HELP!!!!!!

Biology
1 answer:
goldfiish [28.3K]3 years ago
4 0

theres no question or picture sorry

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Which type of metamorphic rock forms when limestone is exposed to heat and pressure?
tatyana61 [14]

Answer:

marble

Explanation:

Its right on ed

7 0
4 years ago
Read 2 more answers
Which of the following situations shows evidence of scapegoating?
ziro4ka [17]
C because I had the same question and my teacher said it was c
7 0
3 years ago
Ill give brainliest
malfutka [58]

Answer:

amino acids

Explanation:

7 0
3 years ago
Read 2 more answers
What process occurs in Box A?
SIZIF [17.4K]

Answer:

The process occurring in Box A is Glycolysis

Explanation:

Glycolysis is the pathway by which glucose, a six-carbon molecule is oxidized to molecules of pyruvate, a three-carbon molecule with the release of ATP and electrons which are carried by NADH molecules.

The process occurs in the cytoplasm of cells and requires 10 glycolytic enzymes.

The pyruvate molecules from glycolysis is first oxidized to acetyl-CoA and carbon dioxide molecules. The acetyl-CoA molecules enter the citric acid cycle occurring in the mitochondria and are used up in the production of  ATP, CO2, and electrons carried by NADH and FADH2.

The electrons carried by NADH and FADH2 from glycolysis and citric acid cycle are used in the oxidative phosphorylation pathway occurring inside the mitochondrion for transformation of oxygen molecules into water molecules with release of ATP.

8 0
3 years ago
Other questions:
  • What are the visible legs that appear when DNA strands coil and condense
    6·1 answer
  • Some birds are known as honey guides because they may be followed by humans to wild beehives. when the humans take honey from th
    10·2 answers
  • Explain how a nerve impulse travels.
    15·1 answer
  • What helps identify cell types?
    7·1 answer
  • .A particular plant species has numerous fruits and no visible seeds. Which of the following could it be? pteridophyta angiosper
    7·1 answer
  • Why is the Big Bang Theory the leading theory on how our universe was
    10·2 answers
  • Inhibiting enzymes involved in cell wall synthesis leads to which of the following? A) cell death by osmotic lysisB) a reduction
    7·1 answer
  • When Edna's great-grandfather returned from World War I, the family recalls that he would sometimes think that he
    15·2 answers
  • HELP PLEASE If carrots were removed from the food web, how might the other populations be affected?
    6·1 answer
  • 1. How are seasons connected to the annual CO2 cycle?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!