Answer:
a. movement can occur both upward and downward in the plant
Explanation:
The phloem loading causes the accumulation of sugars in the sieved elements generating a negative solute potential (quedas), with a drop in water potential (ψw), so water enters the sieved elements increasing the turgor pressure (ψp). With the discharge of phloem in the drain occurs lower concentration of sugars in the screened elements, increases the solute potential, becoming positive, thus the phloem water potential increases and thus the water leaves the conducting vessel. In the specific case of sugar movement in the phloem, it can be stated that this movement can occur both up and down in the plant.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
D
Explanation:
collisions between molecules and atoms push on the container creating pressure
Answer:
above fossils and fossil fuels is 6
above the sheep is 4
above the tree on the right is 1
above the tree on the left is 3
above the city is 5
Explanation:
brainliestttt
Abiotic Factors of Taiga Biome: The abiotic factors includes temperature, sunlight, soil, air, water. In taiga biome the climate is marked by bitterly cold winter of long duration and cool brief summer season. The winter months are always below freezing point.
