1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa05 [86]
1 year ago
15

A sudden drop in sex hormones in a woman's bloodstream along with cessation of ovulation and menstruation signals:____.

Biology
1 answer:
faust18 [17]1 year ago
8 0

A drop in intercourse hormones in a woman's bloodstream along with cessation of ovulation and menstruation signals: menopause.

Menopause is a factor in time 12 months after a woman's last period. The years leading up to that point, when women may additionally have changes in their monthly cycles, warm flashes, or different symptoms, are known as the menopausal transition or perimenopause. The menopausal transition most often starts between a while forty five and 55.

<h3 /><h3>What occurs to a person throughout menopause?</h3>

Your physique goes through a lot of adjustments throughout menopause. There are extreme shifts in your hormone levels, you might also not sleep nicely because of hot flashes and you may also ride mood swings. Anxiety and fear may want to additionally be at play all through this time. All of these elements can lead to depression.

Learn more about menopause here:

<h3>brainly.com/question/3588586</h3><h3 /><h3>#SPJ4</h3>
You might be interested in
How do animal cells and plant cells react differently to osmosis in a hypotonic solution?
Morgarella [4.7K]

Answer;

they both burst

Explanation:

8 0
2 years ago
Jet streams are narrow bands of strong wind that flow between cold and warm air masses. Which direction do these winds blow on E
olchik [2.2K]

Answer:

east west

Explanation:

(*˘︶˘*).。.:*♡good luck!!

6 0
2 years ago
A set of identical twins are together in an introductory biology class. The unit of study is DNA and its structure. The teacher
Hunter-Best [27]

In identical twins, alleles are identical and the order of the bases on the interior of the DNA molecule is identical (Options C and E). It is because genetic material is identical.

<h3>What are identical twins?</h3>

Identical twins refer to individuals produced by the same zygote cell, i.e., they are monozygotic twins.

Since these individuals are produced by the same zygote cell, their genetic material (DNA) will be identical.

Identical twins are useful to understand the exact role of genetics and environment in a given phenotypic trait.

Learn more about identical twins here:

brainly.com/question/17180337

6 0
1 year ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Consider a population of 1001 gray wolves. In this population, a single locus determines coat color. The population is at Hardy-
Alex Ar [27]

Answer: 45 icons

Explanation:

5 0
3 years ago
Other questions:
  • Which of the following is an example of interspecific competition?
    13·2 answers
  • A species with 12 protons and 10 electrons is
    8·1 answer
  • Many organisms depend on the land as a food source. Seasons can affect the amount of food that is available to these organisms.
    14·1 answer
  • Which type of front is least likely to be associated with rainfall?
    15·2 answers
  • A eukaryotic organism...
    5·1 answer
  • Eating local food is often considered a way to "go green" and help the
    11·2 answers
  • As the polypeptide is elongating during translation, what is the ribosome doing?
    7·1 answer
  • What are some careers in biology
    13·1 answer
  • Which federal law does not allow the capture of marine mammals in US
    5·1 answer
  • Condensation of water droplets causes the formation of
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!