1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
3 years ago
6

Primates reproductive strategies (compared to other mammals)

Biology
2 answers:
marissa [1.9K]3 years ago
8 0

<span>The answer is (D) are k-selected. Primates are the most K-selected among mammals. Individuals produce only a few whom they invest a great amount of parental care. Reproductive strategies main goal is to produce offspring and successfully rear them to adulthood.</span>

elena55 [62]3 years ago
6 0

The correct answer is D. are K-selected

Explanation:

In biology, the term k-selected is used to describe species in which there is high parental investment, but a low quantity of offspring. This implies in these species organisms have less offspring but invest in each new organism to guarantee survival. This reproductive strategy is the opposite of r-selected in which there is a high rate of offspring but little parental investment, this causes some individuals to survive while others die.

In the case of primates, they are k-selected because most of the species in primates including apes, gorillas, and humans have only one or two offspring each time, also, the parental investment is higher as offspring stays with parents for a longer time; at the same time, this keeps the population stable as higher parental investment guarantees most offspring survives. Thus, the primates' reproductive strategies are K-selected.

You might be interested in
vertical gene transfer is the transfer of dna by mutation. is the transfer of dna by crossing over. is the transfer of dna betwe
Nookie1986 [14]

According to the research, the correct option is during normal cell division. Vertical gene transfer is the transfer of dna during normal cell division.

<h3>What is Vertical gene transfer?</h3>

It is the one that occurs when genes normally during cell division are transmitted within the same species, that is, from their ancestors from the parental gene to the progeny, as in the case of bacteria that occurs by binary fission when bacteria duplicate.

This transfer of genetic material from parent organisms to offspring is through reproduction within the same species.

Therefore, we can conclude that according to the research, the correct option is during normal cell division. Vertical gene transfer is the transfer of dna during normal cell division.

Learn more about Vertical gene transfer here: brainly.com/question/15447274

#SPJ1

8 0
2 years ago
Darwin observed that finches on the Galápagos Islands have different kinds of beaks
prohojiy [21]

Answer:

?

Explanation:

5 0
3 years ago
What is produced when calcium reacts with fluorine in a synthesis reaction? Ca + F2 →
Sphinxa [80]

The right answer is CaF2

Calcium fluoride is an inorganic compound of formula CaF2. This ionic compound consisting of calcium and fluorine is naturally present in nature in the form of fluorine (also known as fluorite). It is the world's leading source of fluoride.

It is a solid insoluble in water, whose structure is cubic where each atom of calcium is adjacent to eight atoms of fluorine, and each atom of fluorine to four atoms of calcium.

8 0
4 years ago
Read 2 more answers
Carl Linnaeus developed a two word system for naming organism. It was called
ArbitrLikvidat [17]
The two-word system that was developed by Carl Linnaeus for naming an organism is called binomial nomenclature. Carl is also known as "Father of Taxonomy".  This system names species by giving them a two-part name. Both of the names of the living species are of Latin grammatical forms. Carl lived from 1707 until his death is 1778. He published a book called "Philosophia Botanica" in 1751. The book showed his way to keep up a botanical garden and his taxonomy system. 
6 0
4 years ago
Read 2 more answers
Harry has an old freezer at home. it is rated at 233 watts. harry plugs in the freezer all the time. however, it runs only for 1
Naily [24]
Not the right subject, but anyway,
233 W * 0.001 kW/W 10.8 hours a day * 365 days a year 
= 233*0.001*10.8*365 kW-hours/year
= 918.5 kW-h/year
7 0
4 years ago
Other questions:
  • Consider this plant cell. Which organelle is labeled A?
    7·2 answers
  • All life on earth exists in a region know as
    15·1 answer
  • If you wanted to study the diversity of organisms at all levels of biological organization what Would You Study
    11·2 answers
  • Asexual reproduction in hydra is called​
    6·1 answer
  • Dexamethasone is a drug that suppresses the secretion of ACTH. If you give Dexamethasone to someone with normal hormone levels,
    8·1 answer
  • Which of these must occur during S phase of the cell cycle so that two daughter cells can be produced during M phase?
    12·2 answers
  • Question 2 of 26
    14·1 answer
  • 11/13/2020
    8·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • HELLO
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!