1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
6

so my grandfather wanted brownies since the cheesecake was gone... they are currently making... I told them that they are lucky

I don't have pot because they'd both be high lol​
Biology
1 answer:
notsponge [240]3 years ago
3 0
I did it but it wasn’t good enough to do that it was so weird I was like lol dev
You might be interested in
Which of the following is the largest particle in soil? A-clay B-sand C-silt D-humus
Akimi4 [234]

Well the soil classification is usually done on the basis of particle sizes and composition of soil.

<span>Clay </span>usually consists of particles less than 0.075 mm in size. It is a sticky soil and shows great changes in volume with variation in its water contact. It also shows considerable strength when air dried.

<span>Silt </span>has larger particles than clay and are mainly inorganic in nature. The particle size is less than 0.075mm and exhibits slightly plastic or non plastic behaviour.

Humus is soil consisting of dead and decaying organic matter. It is mainly organic in content but some inorganic particles may be mixed in it. The top soil in a tropical forest may be considered as humus.

7 0
3 years ago
Choose the correct sequence of the prokaryotic operon. A) gene, operator, promoter B) promoter, operator, gene C) operator, prom
Harrizon [31]

Answer:

The correct answer is option B, that is, promoter, operator, gene.

Explanation:

In a prokaryote, just in front of the operator, the promoter is located, and just in front of the structural genes, the operator is located. All these in combination give rise to an operon.  

Any gene, which codes for an enzyme or a structural protein is termed as a structural gene, in the lac operon, a structural gene codes for three distinct kinds of enzymes. A short sequence of DNA is situated just in front of the structural gene, which is known as the operator. An operator functions as a switch for transcription, that is, it monitors whether the process of transcription will take place or not.  

Just in front of an operator, a sequence of a promoter is present, and for the transcription and translation of all the structural genes, the RNA polymerase needs to combine first with the promoter. In case, if no transcription is to take place, then the operator allows the repressor to bind with it and prevent the attachment of RNA polymerase with the promoter. Hence, the correct sequence of a prokaryotic operon is a promoter, operator, and gene.  

4 0
3 years ago
Cocaine exerts its pleasurable effects on the brain by:
Semenov [28]

It disconnects the brain's dopamine system.

Further explanation

Cocaine

Cocaine is a capably addictive stimulant medication. For a great many years, individuals in South America have bitten and ingested coca leaves which is source of cocaine, for their stimulant effects. In the mid-1900s, refined cocaine was the primary dynamic fixing in numerous tonics and elixirs created to treat a wide assortment of diseases and was even a fixing in the early plans of Coca-Cola. Prior to the advancement of manufactured specialists utilized cocaine for the relief of pain. However, examine has since demonstrated that cocaine is an effectively addictive substance that can change cerebrum structure and capacity whenever utilized over and over.

Functions of cocaine

It shows very quickly effect after a solitary portion and vanish inside a couple of minutes to 60 minutes. Limited quantities of cocaine for the most part make the person feel euphoric, enthusiastic, loquacious, rationally caution, and easily affected to sight, sound, and contact. The medication can likewise briefly diminish the requirement for sustenance and sleep. Some clients find that cocaine encourages them perform straightforward physical and scholarly assignments all the more rapidly, in spite of the fact that others experience the contrary impact.

Effect of cocaine on dopamine

Cocaine particles block the dopamine transporters which shut down the neuron's capacity to take-up the additional dopamine inside the synaptic parted. This outcomes in expanded degrees of the synapse dopamine present in the extracellular spaces among these neurons.

Answer details

Subject: Biology

Level: College

Key words

  • Cocaine
  • Functions of cocaine
  • Effect of cocaine on dopamine

Learn more to evaluate

brainly.com/question/12887489

brainly.com/question/10560288

brainly.com/question/12603071

7 0
3 years ago
Read 2 more answers
Which one of the following is a characteristic of a metal?
alex41 [277]
B) Most metals conduct heat readily. In pure elemental forms, they neither have basic or acidic properties. Other properties include malleability, high melting points, high densities, and electric conduction.
4 0
3 years ago
Read 2 more answers
16
Rainbow [258]

Answer:

An organism with five pairs of chromosomes can have 32 genetic possibilities from a variety independent of its single gamete.

6 0
3 years ago
Other questions:
  • if cells are placed in pure water, will water will move intothe cells faster than it will move out of the cells?
    8·1 answer
  • What is a good property of an indicator? Name two
    13·1 answer
  • How is the secondary response different from the primary response in terms of antibody concentration in the blood? the secondary
    5·1 answer
  • What are the differences between a plant and animal cell?
    8·1 answer
  • What is the source of energy for aquatic communities? How does energy circulate among organisms in an aquatic community?
    9·1 answer
  • List 2 ways predators can catch prey
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What function do the mitochondria perform?
    10·2 answers
  • Why are there no gram-positive archaea species but there are gram-positive bacteria species
    15·1 answer
  • You stain a sample of bacteria using the Gram stain and see gram-positive rods. You then test a sample of the same bacteria usin
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!