1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
4 years ago
13

There is a jar on the cabinet by the refrigerator. savannah pours two hundred eight milliliter of water in the jar six times to

fill it, how many liters of water does it take to fill the jar?
Biology
2 answers:
disa [49]4 years ago
7 0
So 208 divided by 6 would be 34.666
Ronch [10]4 years ago
5 0

Answer:

It will take 1 liter and 248 mL to fill the jar.

Explanation:

To solve this question you need to know how many milliliters the jar can handle until it is full.

As you saw in the question above, it was necessary for Savannah to pour 208 milliliters of water eight times into a jar in order for the jar to be full.

This way we can calculate how many milliliters the jar supports, multiplying 208 * 8 = 1248 milliliters.

Knowing that 1 liter is equal to 1000 milliliters, we can divide the value shown above by 1000 to find out how many liters are needed to fill the jar.

1248/1000 = 1 liter and 248 mL

You might be interested in
ASAP
Vilka [71]

Answer:

A) The proteins float

Explanation:

The proteins float around freely

8 0
3 years ago
Read 2 more answers
Scientific theories _____.
MAXImum [283]
I believe they can be changes and revised
6 0
3 years ago
The semi fluid matrix that surrounds organelles in a cell is called the
Nitella [24]

The semi fluid matrix that surrounds organelles in a cell is called the cytoplasm.<span>
<span>Organelles are the specialized structure with in a cell. Some biologist says that organelle is a cell compartment. Mitochondria and plastids are two broad classes of organelles. Cytoplasm is a thick substance which fills each cell.</span></span>

8 0
4 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
if each triplet of nitrogenous (3 bases in a row, such as GAC) on DNA codes for a specific amino acid how many amino acids will
Charra [1.4K]

Answer: 20

Explanation:

7 0
3 years ago
Other questions:
  • Which enzyme functions to prevent supercoiling of the DNA molecule during replication?
    7·2 answers
  • Dominance hierarchies
    8·1 answer
  • What materials are bones first made out of?
    12·1 answer
  • _________ are the food factories of the plants .​
    10·1 answer
  • An organ composed mainly from epithelial and nervous tissues converts vibrations into impulses that are sent to the brain . Whic
    12·1 answer
  • Comparing cells- size and shape relate to _____?
    8·1 answer
  • The image to the left is
    6·2 answers
  • PLS HELP ME TEST NEEDS TO BE TURNED IN NOW
    7·2 answers
  • Which one of the following was not described as part of the eukaryotic endomembrane system?
    13·1 answer
  • A 15-yr-old girl had a seizure this morning and was rushed to the hospital. On examination, her temperature is 40C and she had n
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!