1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Taya2010 [7]
2 years ago
9

What source of energy is needed in both of these systems to drive these cycles?

Biology
1 answer:
zimovet [89]2 years ago
4 0
It comes from the sun. The sun evaporated earth water
You might be interested in
Organisms ______ to changes in their surroundings.
Romashka [77]
Organisms adapt to changes in their surroundings.
6 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
How long does it take to get a replacement naturalization certificate.
Brilliant_brown [7]
Regular processing time for a replacement citizenship certificate application takes 6 months. However, if you can prove that you need your certificate urgently, either to travel or to keep or get a job that requires proof of citizenship, you may be able to apply for an urgent citizenship certificate.
4 0
2 years ago
Mention the type of census operation​
Oxana [17]

Answer: enumeration area

Explanation:

7 0
3 years ago
Read 2 more answers
Giving brain liest for who ever does all, IN YOUR OWN WORDS< please and thak you i am giving brain liest :) i need a pro to h
N76 [4]

Answer:

Breathing is when u breath out corbin dioxied and breath in air Breathing is important because if u dont breath then u could die. i onestley dont know what a diagram is srry.....ummmm im srry i tried my hardest i dont know what the other things are .

Explanation:

3 0
3 years ago
Other questions:
  • URGENT!! I need this before tomorrow, please! How does the polar jet stream affect temperature and precipitation in North Americ
    6·1 answer
  • In the traditional morphological phylogeny (a), the phylum platyhelminthes is depicted as a sister taxon to the rest of the prot
    12·1 answer
  • What is the structure that carries blood to the kidney?
    15·1 answer
  • Worth 20 points help The moon does not have its own
    12·2 answers
  • What is the most endangered shark species
    14·1 answer
  • Brown eyes in humans is a dominant trait. we inherit dominant traits from our parents, some from our mother and some from our fa
    8·2 answers
  • In an environment, too many organisms of one species is present, exceeding the carrying capacity. What is most likely? A The ani
    10·1 answer
  • Which of the following is
    12·1 answer
  • WILL MARK BRAINLIEST
    15·2 answers
  • What is matter and mass ​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!